ID: 912189299

View in Genome Browser
Species Human (GRCh38)
Location 1:107318929-107318951
Sequence CTGTATATCTTCAGACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912189299_912189303 5 Left 912189299 1:107318929-107318951 CCTTCCTGTCTGAAGATATACAG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 912189303 1:107318957-107318979 CTCTAGAATTGTGGTCATCAGGG 0: 1
1: 0
2: 2
3: 13
4: 126
912189299_912189302 4 Left 912189299 1:107318929-107318951 CCTTCCTGTCTGAAGATATACAG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 912189302 1:107318956-107318978 TCTCTAGAATTGTGGTCATCAGG No data
912189299_912189301 -4 Left 912189299 1:107318929-107318951 CCTTCCTGTCTGAAGATATACAG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 912189301 1:107318948-107318970 ACAGTTTGTCTCTAGAATTGTGG 0: 1
1: 0
2: 1
3: 12
4: 143
912189299_912189304 24 Left 912189299 1:107318929-107318951 CCTTCCTGTCTGAAGATATACAG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 912189304 1:107318976-107318998 AGGGCTTGTTAGTATGTTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912189299 Original CRISPR CTGTATATCTTCAGACAGGA AGG (reversed) Intronic
901487148 1:9572059-9572081 CTATAAATATTCAGACAGGTTGG - Intronic
908620288 1:65971689-65971711 CTGAAAATATTCAGAGAGGATGG + Intronic
909057276 1:70836571-70836593 CGATAAATCTTCTGACAGGAAGG - Intergenic
909484527 1:76158423-76158445 CTTTATATCTTCAGTCTGTAGGG + Intronic
910562876 1:88611420-88611442 CTCTATTTCTTCAGACAGTCTGG - Intergenic
910896384 1:92074292-92074314 CAGTTTTTGTTCAGACAGGAAGG + Intergenic
911000716 1:93162649-93162671 ATGAAAATCTTCAGACAGAAAGG + Intronic
912189299 1:107318929-107318951 CTGTATATCTTCAGACAGGAAGG - Intronic
912305522 1:108562211-108562233 CTGTGTAACTTCAAACAGGGTGG + Intronic
916301705 1:163282701-163282723 CTGTTTATTTAGAGACAGGAGGG - Intronic
916532404 1:165669775-165669797 CTGTATATTTTAAGAATGGAAGG + Intronic
916573506 1:166047532-166047554 ATGTAGCTCTTCAAACAGGAGGG - Intergenic
917568925 1:176243601-176243623 CAGTAAAACTTCAGACAGAATGG + Intergenic
917864893 1:179184916-179184938 CAGTTTTTGTTCAGACAGGAAGG - Intronic
919552371 1:199006938-199006960 ATGTATATCTTCCTACAGAAGGG + Intergenic
920744467 1:208613504-208613526 CTGTAAACTTTGAGACAGGAAGG - Intergenic
921178045 1:212609943-212609965 CTGAAAATCTCCAGACAGAAAGG - Intronic
921963339 1:221059513-221059535 CTGAACTTCTTCAAACAGGAAGG + Intergenic
922447066 1:225706639-225706661 TTGTATATCTGTAGAAAGGAAGG + Intergenic
923778822 1:237003642-237003664 ATGTATATCTTCAGTCATAAAGG + Intergenic
1064024543 10:11836662-11836684 CTGTATATCCTGACACAGGAAGG + Intronic
1065630724 10:27678183-27678205 CTGTAAATCTTCACTCAGTAAGG + Intronic
1066310870 10:34195001-34195023 TGGTATATCTTGAGATAGGAAGG - Intronic
1066328470 10:34391440-34391462 CAGTTTTTGTTCAGACAGGAAGG + Intronic
1070167519 10:73909920-73909942 CTGCTTATCCTCAGGCAGGAAGG + Intronic
1072240672 10:93492805-93492827 AAGTTTATCTTCAGCCAGGAAGG - Intergenic
1074522336 10:114237092-114237114 TTGTAAATCTTCACAAAGGAAGG + Intergenic
1079242092 11:18728527-18728549 CTGTGTCTCCTCAGCCAGGAAGG - Exonic
1086705943 11:89951255-89951277 CTTTAGCTCTTCAGCCAGGAGGG + Intergenic
1089484380 11:118833549-118833571 CAGTTTTTGTTCAGACAGGAAGG + Intergenic
1091836790 12:3591834-3591856 ATGAAGATCTTCAGACAGTATGG - Intronic
1092874555 12:12836773-12836795 CTGTGTGTCTTCAGATAAGAAGG - Intergenic
1096255754 12:50061225-50061247 CTGTATTTGTGCAGAAAGGATGG + Intronic
1102641350 12:114369761-114369783 CTGTATTTCTAGAGACAGAAGGG - Intronic
1104072323 12:125356602-125356624 CTGTAGATGTCCAGCCAGGAGGG - Intronic
1107016419 13:35711302-35711324 CTGTATGTTTTCAGACAGGGTGG - Intergenic
1110827665 13:79991391-79991413 CTGTACATTTTCCGACTGGATGG - Intergenic
1111916071 13:94361730-94361752 CTTCATAAATTCAGACAGGAAGG + Intronic
1112689692 13:101878014-101878036 CTGCATATTTCCAGACATGAAGG - Intronic
1115869893 14:37788289-37788311 CTGGATTTCATCAGTCAGGATGG - Intronic
1115997170 14:39206231-39206253 CTCTATATCTTAAAACAGGCTGG + Intergenic
1116087410 14:40258126-40258148 CAGTAAAACTTCAGACAGTAAGG - Intergenic
1117550282 14:56828804-56828826 CTATATATCTACAAACAGGTAGG - Intergenic
1121984246 14:98486575-98486597 CTCTGGATCTTCAGAAAGGAAGG + Intergenic
1127392425 15:58517378-58517400 CTGCATATCTTCACCCAGGAGGG + Intronic
1131678200 15:94693353-94693375 CTTTACATCTTCAGACAGCTAGG + Intergenic
1132331041 15:101012778-101012800 ATGTGTATCCTCAGAGAGGATGG + Intronic
1134422196 16:14104215-14104237 GTGTATTTATTCAGATAGGAAGG + Intronic
1135637793 16:24093801-24093823 GTGTATATCTGCACACAGGTGGG - Intronic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1137823669 16:51469384-51469406 CTGAATCCCTTCAGACTGGATGG + Intergenic
1138211263 16:55165024-55165046 CTGGATGGCTTCAGAGAGGAGGG + Intergenic
1139116450 16:63960057-63960079 CTGTGTATATTCAGACACCATGG - Intergenic
1141006208 16:80354853-80354875 CTGCATCTTTTCAGACAAGATGG - Intergenic
1146845127 17:36177746-36177768 CTGTATATACTCACTCAGGAAGG + Intronic
1146873348 17:36389595-36389617 CTGTATATACTCACTCAGGAAGG + Intronic
1146880702 17:36440677-36440699 CTGTATATACTCACTCAGGAAGG + Intergenic
1153918999 18:9771978-9772000 CTGTAACTCTTCAGACAAGTTGG + Intronic
1155068091 18:22286011-22286033 CTTTATAATTTAAGACAGGAAGG + Intergenic
1157585801 18:48800489-48800511 AGGTATCTCTGCAGACAGGAGGG - Intronic
1161590070 19:5125527-5125549 CTGTACATCTTTAAACAGGATGG - Intronic
1163007021 19:14403357-14403379 ATTTATATTTTTAGACAGGAGGG + Intronic
929093849 2:38245597-38245619 CTGTACATCCTCAGGAAGGAAGG + Intergenic
930778432 2:55198124-55198146 CTGTATATTTTCAGATAGTCTGG - Intronic
931257812 2:60589175-60589197 CTGTGTATTTTCAGTTAGGATGG + Intergenic
933571384 2:84017409-84017431 CTGTGTATTTTCTGTCAGGATGG - Intergenic
936718057 2:115213485-115213507 CAGTATATGATCAGTCAGGATGG - Intronic
937026209 2:118699802-118699824 CTGTTTATCTTCAGTAGGGAGGG + Intergenic
937667968 2:124508187-124508209 CTGTATCTCTTGAGTCAGCACGG - Intronic
940826620 2:158419793-158419815 TTGTATATTTTCACAAAGGAGGG - Intronic
943003464 2:182359794-182359816 CTGAGTTTCCTCAGACAGGAAGG - Intronic
943132628 2:183873522-183873544 AAGTATATTTTCAGACATGAAGG - Intergenic
946276632 2:218636533-218636555 GTGTATATCTGCATCCAGGAAGG + Exonic
946497543 2:220210139-220210161 CTTTGTATCTTCAGTCAGAAAGG - Intergenic
946498315 2:220218720-220218742 CTTCATCTCTTCAGCCAGGATGG - Intergenic
947648009 2:231758957-231758979 CTCTATACCACCAGACAGGAAGG + Intronic
1182065246 22:27426691-27426713 ATGTATTTCTTCAGTCTGGATGG - Intergenic
1182704768 22:32270257-32270279 CTGAAACTCTTCAGACAGGAAGG - Intergenic
1183026361 22:35068407-35068429 CTGTGTGTCTGCAGGCAGGAAGG + Intronic
1184078306 22:42198631-42198653 CTGTATATATTCAGAACAGATGG + Intronic
950439424 3:13000418-13000440 CTGTACATCTTGAGACAGTGGGG + Intronic
950610390 3:14123241-14123263 CTGTAAATCCTCAAAGAGGAGGG + Intronic
952038974 3:29238867-29238889 CTTTTTATCTTCAGAAAGGCTGG - Intergenic
952413613 3:33071070-33071092 CTGTCTACCTACAGACAGCATGG + Intronic
962047620 3:131777289-131777311 CTGTATAAATGCAGACAGAAAGG + Intronic
964369841 3:155988410-155988432 CAGTTTTTGTTCAGACAGGAAGG - Intergenic
965285557 3:166815144-166815166 CTGTATTTATTCTGAGAGGAGGG - Intergenic
967424919 3:189316125-189316147 GTGCATATGTTCAGAGAGGAGGG + Intronic
967425099 3:189317854-189317876 CTGCATGTGTTCAGAGAGGAGGG + Intronic
970435101 4:16025676-16025698 ATGCATATGTTCACACAGGAGGG - Intronic
971822692 4:31579338-31579360 CTGCATTTCTTGTGACAGGAAGG + Intergenic
974645897 4:64692063-64692085 CTGTATATTTCCATACAGGTGGG + Intergenic
977737177 4:100431079-100431101 GTGAATATGCTCAGACAGGATGG + Intronic
978514099 4:109553002-109553024 CAGTTTTTATTCAGACAGGAAGG + Intergenic
981941295 4:150284132-150284154 CTGTAGATATGCAGCCAGGAAGG + Intronic
986482000 5:8198854-8198876 CTGTATTTCTACAGAGAAGATGG + Intergenic
987060701 5:14240695-14240717 TTGTAGATTTTCAGACAAGACGG + Intronic
987550998 5:19381436-19381458 GTTTATGTCTTCAGAGAGGATGG + Intergenic
993428131 5:87795898-87795920 CTTTATATATTCAGACATGGAGG - Intergenic
994207858 5:97056154-97056176 CAGTTTTTGTTCAGACAGGAAGG + Intergenic
995474628 5:112535106-112535128 CTGTAGATTTTCAGACAGTTGGG - Intergenic
998182720 5:139956560-139956582 CTTCACATCTTCAGAAAGGAAGG - Intronic
998264839 5:140660048-140660070 CTGTAAAGCTTCAGCCAGGAGGG - Intronic
998583068 5:143401449-143401471 CTGCTTATCTTCCGACAGGCTGG + Intronic
999855984 5:155594659-155594681 CTGTACATAGTCAGAAAGGAGGG + Intergenic
1001971548 5:175958979-175959001 ATGTTTATCTTCATACATGAAGG - Intronic
1002245894 5:177884797-177884819 ATGTTTATCTTCATACATGAAGG + Intergenic
1004819245 6:19348862-19348884 CAGCATAACTTCAGACATGAAGG + Intergenic
1005198561 6:23317070-23317092 CTTCATACCTTCAGGCAGGAAGG + Intergenic
1013775753 6:113676819-113676841 AAGAATATCTACAGACAGGAAGG + Intergenic
1014056383 6:117019975-117019997 CATTATATCTTCAGGAAGGAGGG + Intergenic
1023000555 7:35802760-35802782 CTTTATTTCTTCAGACTGCAAGG + Intronic
1023014773 7:35956023-35956045 CAGCATGTCTTCAGCCAGGAAGG + Intergenic
1024066230 7:45738997-45739019 CAGCATGTCTTCAGCCAGGAAGG - Intergenic
1029082473 7:97985649-97985671 CTTTTTGTCTGCAGACAGGAAGG + Intronic
1029291677 7:99506343-99506365 CTGGAACTCTTCAGGCAGGATGG - Exonic
1030717774 7:112830550-112830572 ATGTATATCTTGAGGAAGGAAGG + Intronic
1032907579 7:136388288-136388310 CTTAATATCATCAGACAGTATGG + Intergenic
1034106132 7:148491362-148491384 CTGTAGAGCTTCAGCCAGTAAGG - Intergenic
1035399096 7:158553158-158553180 CTGTATGTGTGTAGACAGGAAGG - Intronic
1035854877 8:2964099-2964121 TTGTGTATCTTCAGAGAAGAAGG - Intronic
1041760963 8:61365819-61365841 CTCTATGTCATTAGACAGGAAGG + Intronic
1041829882 8:62142539-62142561 CTGTAATTCTTCAGAAAGGGTGG - Intergenic
1042097368 8:65232042-65232064 TTGTGCATCTACAGACAGGAAGG - Intergenic
1043024643 8:75050376-75050398 CTGTATATCTTCACATAGTTGGG + Intergenic
1043803136 8:84637041-84637063 ATGTATATTTTCTGATAGGAAGG - Intronic
1044979538 8:97702153-97702175 ATGTATGTCTTCAAACTGGAGGG - Intronic
1048663799 8:136637479-136637501 GTATATTTCTTCAGACAGCATGG + Intergenic
1050192170 9:3038067-3038089 ATGTGTATCTTTAGAAAGGAGGG + Intergenic
1055162218 9:73143989-73144011 CTGTATATTTTTAAACAGGCAGG - Intergenic
1055256217 9:74374409-74374431 CTGAATATCTTCCCACAGGAAGG + Intergenic
1056253482 9:84774347-84774369 CTGAATCTCAACAGACAGGATGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1061128818 9:128694900-128694922 CAGTTTTTGTTCAGACAGGAAGG - Exonic
1061736736 9:132666296-132666318 CTCTATTTCTTCAGACAGTCTGG - Intronic
1061882961 9:133577201-133577223 CTACATATCTACAGAGAGGATGG + Intergenic
1188632855 X:32389755-32389777 CTGTATATCTTCAGAAATAAAGG - Intronic
1189935570 X:46064955-46064977 CTAAATATCTTCAGGAAGGAGGG - Intergenic
1198128467 X:133670943-133670965 CTGTCTATCCTCAGACAGCCAGG - Intronic