ID: 912189334

View in Genome Browser
Species Human (GRCh38)
Location 1:107319245-107319267
Sequence CAGAAGGACTTGAGGCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 449}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912189330_912189334 -4 Left 912189330 1:107319226-107319248 CCAAGCAAGAATTTGGGAGCAGA 0: 1
1: 0
2: 2
3: 31
4: 223
Right 912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 449
912189327_912189334 7 Left 912189327 1:107319215-107319237 CCATGCTATAGCCAAGCAAGAAT 0: 1
1: 0
2: 1
3: 10
4: 134
Right 912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 449
912189326_912189334 8 Left 912189326 1:107319214-107319236 CCCATGCTATAGCCAAGCAAGAA 0: 1
1: 0
2: 2
3: 9
4: 120
Right 912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 449
912189325_912189334 12 Left 912189325 1:107319210-107319232 CCTTCCCATGCTATAGCCAAGCA 0: 1
1: 0
2: 1
3: 10
4: 103
Right 912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912189334 Original CRISPR CAGAAGGACTTGAGGCAAGG AGG Intronic
900111186 1:1006271-1006293 CAGCAGGACCTGAGACAGGGCGG - Intergenic
900889637 1:5440377-5440399 CAGAGGGATTTGAGACAGGGAGG + Intergenic
900987349 1:6080811-6080833 CAGAAGCCCTTGTGGCCAGGAGG - Intronic
901488862 1:9585694-9585716 ATGAAGGACTTGAGCCCAGGAGG + Intergenic
902635557 1:17732928-17732950 CAGAGGGACCTGAGGCCATGAGG + Intergenic
902786703 1:18737229-18737251 CAGAAGGGCGTGTGGCAAGAGGG + Intronic
902901130 1:19516885-19516907 CTGTAGGACTTAAGGCATGGAGG + Intergenic
903312345 1:22469407-22469429 GAGAATGGCTTGAGGCCAGGAGG - Intronic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
904821915 1:33251069-33251091 GTGAAGGCCATGAGGCAAGGAGG + Intergenic
905155931 1:35981752-35981774 CAGAAGGAGGTAAGGAAAGGAGG - Intronic
905776012 1:40667582-40667604 CAGAAGGACTGGATGGGAGGTGG + Intergenic
905937142 1:41833757-41833779 CAGAATGACTTGGGGAAAGGAGG - Intronic
906089503 1:43166516-43166538 CAGAATTACTTGAGCCCAGGTGG + Intronic
908156111 1:61355235-61355257 CAGAAACACTTGAGGGAAGCAGG - Intronic
908185432 1:61648256-61648278 AAGAAGGAGATGTGGCAAGGTGG + Intergenic
910671183 1:89774519-89774541 GAGAATCACTTGAGCCAAGGAGG - Intronic
911039649 1:93581909-93581931 CTGATGGAGCTGAGGCAAGGGGG + Intronic
911048611 1:93650293-93650315 GAGAATGACTTGAGCCCAGGAGG + Intronic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
912495587 1:110089379-110089401 AAGAAGGCATTGAGACAAGGTGG + Intergenic
913302937 1:117392087-117392109 AGGATTGACTTGAGGCAAGGTGG - Intronic
914770880 1:150683611-150683633 CAGAAGTACTTGAACCCAGGAGG + Intronic
918084055 1:181230257-181230279 CGGAAGGACCTTGGGCAAGGTGG - Intergenic
922178192 1:223213440-223213462 CAGAAGGCCCTGGGGCCAGGGGG + Intergenic
922421183 1:225462085-225462107 GAGAAGGTGTTGAGGGAAGGAGG + Intergenic
922719540 1:227893270-227893292 CAGAAGAACTTGAGTCTCGGAGG - Intergenic
922897395 1:229111080-229111102 GAGAATCACTTGAGGCCAGGAGG + Intergenic
923097750 1:230788958-230788980 AAGCAGGACATGAGTCAAGGAGG - Intronic
923706537 1:236348809-236348831 GAGAAGGACTGGAGAAAAGGTGG - Intronic
1063072191 10:2677941-2677963 GAGAATCACTTGAGCCAAGGAGG - Intergenic
1063455495 10:6179612-6179634 CAGGAGGACTGCAGGCAAGAGGG + Intronic
1063693791 10:8313043-8313065 CAGAAGGGCTAGAGCCAAAGAGG + Intergenic
1064284718 10:13982391-13982413 GAGAATGACTTGAGCCCAGGAGG + Intronic
1064995869 10:21296312-21296334 CAGAATCACTTGAACCAAGGAGG + Intergenic
1065134987 10:22659084-22659106 CAGAGGGACCTGAGGCCAGAGGG - Intronic
1065504988 10:26421170-26421192 GAGAAGCACTTGAGCCCAGGAGG + Intergenic
1066071719 10:31822358-31822380 CAGAAGGACTTGATGGAAAAGGG + Intronic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1070224047 10:74482272-74482294 CAGAAGGAAGTGAGACAAGGGGG + Intronic
1070687186 10:78495092-78495114 GAGAAGCACTTGAGTCCAGGAGG + Intergenic
1071502610 10:86214315-86214337 CAGAAGTACTTTAGGCAGTGGGG - Intronic
1072447015 10:95507818-95507840 AAGAATCACTTGAGTCAAGGAGG + Intronic
1073492985 10:103867204-103867226 CAGAATTACTTGAGCCCAGGAGG - Intergenic
1073918167 10:108429873-108429895 CAGAAAAACGTGAAGCAAGGAGG - Intergenic
1074453092 10:113575377-113575399 CAGAAGAATTGGCGGCAAGGAGG - Intronic
1074754572 10:116615053-116615075 GAGAAGGACTTTAGGAAATGGGG + Intergenic
1074937338 10:118194900-118194922 GAGAATGGCTTGAGGCCAGGAGG + Intergenic
1076231032 10:128820285-128820307 CAGAATCACTTGAGCCCAGGAGG + Intergenic
1077039368 11:512031-512053 AAGAATCACTTGAGGCCAGGAGG - Intergenic
1077391851 11:2303944-2303966 CAGACGGCCCTGAGGGAAGGAGG - Intronic
1077641485 11:3885725-3885747 GAGAATCACTTGAGCCAAGGAGG - Intronic
1078456992 11:11483170-11483192 CAGCAGGCATAGAGGCAAGGAGG - Intronic
1079769479 11:24441698-24441720 CAGAATCACTTGAGTCCAGGAGG - Intergenic
1080749310 11:35138363-35138385 CAGAAGGACATAAGGAAAGATGG + Intergenic
1080916781 11:36667941-36667963 CCGAAGGACTTGAAACAAGATGG - Intergenic
1081544166 11:44058081-44058103 GAGAATCACTTGAGCCAAGGAGG + Intronic
1083180200 11:60980410-60980432 GAGAATGACTTGAGCCCAGGAGG + Intronic
1084193604 11:67510508-67510530 CAGAAGGAGTTGGGGCTTGGTGG - Intergenic
1086546425 11:87972969-87972991 CAGAAGGAAGAGAGGAAAGGGGG - Intergenic
1086799264 11:91151755-91151777 CAGAAGGAATAGAGTAAAGGGGG + Intergenic
1086942949 11:92816884-92816906 GAGAATCACTTGAGCCAAGGAGG + Intronic
1087253028 11:95924355-95924377 GATAAGGACCTGAGGCCAGGAGG + Intronic
1088469509 11:110177834-110177856 TAGAAGGATTTGAGGCAGGGTGG - Intronic
1088762468 11:112945288-112945310 CAGAAAGAACTGAGGAAAGGTGG + Intergenic
1089468619 11:118703085-118703107 GAGAAGCACTTGAGCCCAGGAGG + Intergenic
1090596013 11:128322137-128322159 GAGAATGACTTGAGCCTAGGAGG - Intergenic
1090702959 11:129312837-129312859 CGGGAGGATTTGAAGCAAGGTGG + Intergenic
1090761947 11:129845590-129845612 CAGCAGGAAATGAGGCACGGAGG + Intronic
1090836538 11:130458282-130458304 GAGGACGACTTGAGGCCAGGAGG - Intronic
1092745569 12:11669334-11669356 CAGGAGGACGGGAGGAAAGGAGG - Intronic
1092899819 12:13047818-13047840 GAGTAGGACTTAAGGCAAGTTGG + Intronic
1092979462 12:13779131-13779153 GAGAAGCACTTGAAGCCAGGAGG - Intronic
1093619017 12:21265004-21265026 CAGGAGGACATGAGGAGAGGAGG + Exonic
1093732604 12:22582905-22582927 GAGAATGACTTGAGCCTAGGAGG + Intergenic
1093974576 12:25407286-25407308 GAGAAGCACTTGAAGCCAGGGGG - Intergenic
1094581552 12:31738486-31738508 TTGAAGGATTAGAGGCAAGGAGG - Intergenic
1095425817 12:42073531-42073553 CAGAAGCACTTGAACCCAGGAGG + Intergenic
1095898141 12:47301280-47301302 GAGAATGACTTGAAGCCAGGAGG - Intergenic
1096591546 12:52663250-52663272 CATAAGGCTTTGAGGAAAGGTGG - Intergenic
1097026907 12:56063608-56063630 GAGAATGACTTGAGCCCAGGAGG - Intergenic
1097251719 12:57637457-57637479 GAGATGGACTTGAGCCCAGGAGG - Intergenic
1098538693 12:71625598-71625620 CAGGAGGACTTGGGTCCAGGAGG + Intronic
1099305657 12:80951825-80951847 CATAAAGACCTGAGGGAAGGGGG - Intronic
1099916452 12:88901032-88901054 CAAAGGGACTTGAGGGAATGAGG - Intergenic
1100687580 12:97003732-97003754 AAGGAAGACTTGAAGCAAGGTGG + Intergenic
1101221555 12:102646668-102646690 CAGAACCACTTGAAGCCAGGAGG + Intergenic
1101403028 12:104404679-104404701 GAGGATGACTTGAGCCAAGGAGG + Intergenic
1101942946 12:109113896-109113918 CAGAAGGACTCTAAACAAGGAGG - Intergenic
1101985132 12:109440122-109440144 CAGAATCACTTGAGCCTAGGAGG - Intronic
1102844617 12:116166137-116166159 GAGAATCACTTGAGGCCAGGAGG + Intronic
1103777023 12:123373764-123373786 GAGAATCACTTGAGGCCAGGAGG - Intergenic
1104408414 12:128538018-128538040 CAGGATCACTTGAGGCCAGGAGG - Intronic
1105496625 13:20936182-20936204 GAGAATCACTTGAGGCTAGGAGG + Intergenic
1106461910 13:29978157-29978179 CTGAAGGAATTGCGGAAAGGAGG + Intergenic
1106722785 13:32453164-32453186 CAGAAGTGCTTGAGCCAAAGAGG + Intronic
1106923544 13:34589702-34589724 CAGAAGGGAGGGAGGCAAGGAGG + Intergenic
1109588470 13:64443083-64443105 GAGGATGACTTGAGCCAAGGAGG - Intergenic
1111883403 13:93987933-93987955 GAGCAGGACAAGAGGCAAGGAGG - Intronic
1113483674 13:110639370-110639392 CTGGAGGACTTGAGGCATGCTGG + Exonic
1113788727 13:113016278-113016300 AAGAAGGATTTGACACAAGGGGG + Intronic
1113910740 13:113840088-113840110 CAGCAGGCCTGGACGCAAGGTGG + Intronic
1114541484 14:23463349-23463371 CAGGATCACTTGAGGCAGGGAGG + Intergenic
1115450613 14:33543133-33543155 CAGAAAGAGATGAGGGAAGGAGG - Intronic
1115709877 14:36039215-36039237 CAGGAGGACTAGGGGCAAGGAGG + Intergenic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1118212199 14:63775668-63775690 GAGGATCACTTGAGGCAAGGAGG - Intergenic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1120501223 14:85299515-85299537 CAGATGGAGTTGAGGCAGAGAGG - Intergenic
1121501212 14:94439871-94439893 CAGAAGAACTTGAGGCACAGAGG + Intergenic
1121527281 14:94627874-94627896 CAGAAGGACAGGAGTCAAGGGGG + Intergenic
1121709918 14:96030231-96030253 CAGAAGCAGTTGAGGCCAGCAGG - Intergenic
1121816647 14:96933869-96933891 CAGAATGACTTTTGGGAAGGGGG + Intergenic
1121924388 14:97914649-97914671 CAGCAGGACTGGAGGCTATGAGG - Intergenic
1122314585 14:100818222-100818244 GAGGAGGCCATGAGGCAAGGTGG - Intergenic
1124241774 15:28034200-28034222 GAGAATCACTTGAGGCCAGGAGG + Intronic
1124715592 15:32058180-32058202 CAGAGGGAAAGGAGGCAAGGAGG - Intronic
1124784039 15:32662635-32662657 GAGGAAGACTTGAGGCAAGTTGG + Intronic
1125433058 15:39616809-39616831 AAGAGAGACTTGAGGCAGGGAGG + Intronic
1126603763 15:50455163-50455185 GAGAATCACTTGAGGCCAGGAGG - Intronic
1126848782 15:52785353-52785375 AAGAAGGACCTGAGCCAAGGGGG - Intronic
1128229631 15:66025437-66025459 GGGAGGGACTTGAGGCGAGGAGG + Intronic
1132380336 15:101361782-101361804 CAGTAGGGGTTGAGGCAGGGGGG + Intronic
1132432786 15:101774450-101774472 GAGAATCACTTGAGGCCAGGAGG - Intergenic
1133453434 16:5922391-5922413 CACAAGGAGATGTGGCAAGGAGG + Intergenic
1133820798 16:9234970-9234992 CCCAAGGACTTGAGCCCAGGAGG - Intergenic
1134021734 16:10925744-10925766 AAAGAGGACTTGAGCCAAGGTGG - Exonic
1134058245 16:11183332-11183354 CAGTAGGACGTGGGGGAAGGGGG - Intergenic
1134375069 16:13664548-13664570 CTGAAGGTATTAAGGCAAGGTGG - Intergenic
1134565592 16:15249223-15249245 CAGAAGGACTTGAAGATAAGTGG + Intergenic
1134736903 16:16507475-16507497 CAGAAGGACTTGAAGATAAGTGG - Intergenic
1134930612 16:18204698-18204720 CAGAAGGACTTGAAGATAAGTGG + Intergenic
1135259981 16:20972460-20972482 GAGGATGGCTTGAGGCAAGGAGG - Intronic
1135980696 16:27144523-27144545 AAGAATGACTTGAGCCCAGGAGG + Intergenic
1137453963 16:48603965-48603987 CACAAGGATTGGAGGTAAGGGGG - Intronic
1137478743 16:48833512-48833534 CAGAAGGGCTTGAGGAGAGGTGG + Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1138930513 16:61649743-61649765 CATAAGGACTGAAGGCAAGTAGG - Exonic
1139477347 16:67209316-67209338 CACAAGAACTTGAGGCCTGGAGG + Intronic
1139961040 16:70717348-70717370 GAGGAGGACTTGAGGACAGGAGG + Intronic
1140218253 16:73025239-73025261 GGGAAGGACTTGGGGCAGGGCGG - Intronic
1140229292 16:73104318-73104340 CAGAATCACTTGAGCCCAGGAGG - Intergenic
1141672380 16:85499047-85499069 CAGGAGGAGTTGAGGCCAGATGG + Intergenic
1141815157 16:86404708-86404730 CAGGAAGACCTGAGGGAAGGCGG - Intergenic
1141961223 16:87410752-87410774 CAGCAGGCCTGCAGGCAAGGTGG - Intronic
1141990961 16:87609354-87609376 GAGAATGACTTGAGCCCAGGAGG - Intronic
1142744484 17:1948880-1948902 GAGAATGACTTGAGCCCAGGAGG - Intronic
1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG + Intronic
1144596879 17:16577318-16577340 TGGAAAGACTGGAGGCAAGGAGG + Intergenic
1145282030 17:21475191-21475213 AGGAGGAACTTGAGGCAAGGAGG - Intergenic
1145741292 17:27276868-27276890 GAGAAGGACTTGGGGGAAGGCGG - Intergenic
1146779359 17:35654149-35654171 AAGAATCACTTGAGCCAAGGAGG - Intronic
1147199085 17:38787681-38787703 GAGAATCACTTGAGGCCAGGAGG - Intronic
1147225949 17:38977189-38977211 GAGAATGGCTTGAGGCCAGGAGG + Intergenic
1148694594 17:49551393-49551415 CAGAAGGACTTTCGAGAAGGAGG + Intergenic
1149547062 17:57511494-57511516 CAGCAGGACTTGAGCCCAGATGG - Intronic
1150687850 17:67335036-67335058 CAGAATCACTTGAGCCCAGGAGG - Intergenic
1150724419 17:67640091-67640113 CAGATGGACTTGAGGGAAACGGG - Intronic
1151059237 17:71071860-71071882 CAGAAGAACTGGAGGAAATGGGG + Intergenic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1152015700 17:77749013-77749035 CAGAATCACTTGAGCCCAGGAGG + Intergenic
1153953430 18:10076241-10076263 CAGGAGGTCATGAGGAAAGGAGG - Intergenic
1155347381 18:24871932-24871954 CAGAAGGTTCTGAAGCAAGGAGG - Intergenic
1155461884 18:26091936-26091958 AAGAATCACTTGAGCCAAGGGGG + Intergenic
1155803685 18:30140411-30140433 CAGGACAACTTGAGGCGAGGAGG + Intergenic
1157480180 18:48048848-48048870 TAGAAGTACCTGAGACAAGGAGG - Intronic
1157519544 18:48336106-48336128 CAGAAAGACTGGAGGCAGGAGGG - Intronic
1158458518 18:57628042-57628064 CAGGAAGACTTGAAGCAGGGAGG + Intergenic
1158634337 18:59143261-59143283 GAGAATCACTTGAGCCAAGGAGG + Intronic
1159258704 18:65981857-65981879 CAGAATGAGTTCAGGCAAAGGGG - Intergenic
1159785007 18:72703186-72703208 CAGAGGTATTTGAGTCAAGGAGG - Intergenic
1160128688 18:76204688-76204710 AAGACAGACTTGAGGGAAGGTGG - Intergenic
1160177573 18:76608294-76608316 CAAAAGGACTACAGGCATGGTGG + Intergenic
1160385725 18:78495145-78495167 CAGAAGGACTTGATTAAATGCGG - Intergenic
1160456336 18:79004608-79004630 CAGAAGGTCTTGCAGAAAGGGGG + Intergenic
1161656681 19:5520232-5520254 GAGAATCACTTGAGGCCAGGAGG + Intergenic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1161773140 19:6242116-6242138 GAGCAGGTCTTGAGGCAGGGAGG - Intronic
1161917542 19:7240480-7240502 CAGAATTGCTTGAGGCAAGGCGG + Intronic
1162106791 19:8374685-8374707 AAGAATCACTTGAGCCAAGGAGG + Intronic
1162120643 19:8464866-8464888 CTGAAGGACTTGAAGGATGGGGG + Intronic
1162176833 19:8836579-8836601 GAGAATGACTTGAGCCCAGGAGG - Intronic
1162678762 19:12322143-12322165 CAGAATCACTTGAGCCCAGGAGG - Intronic
1163242507 19:16072815-16072837 GAGAAGCACTTGAGCCAGGGAGG + Intronic
1163279585 19:16307314-16307336 CAGGAAGACTTGAAGCCAGGAGG - Intergenic
1163351441 19:16778596-16778618 GAGAATGACTTGAGCCCAGGAGG - Intronic
1163716532 19:18875869-18875891 CAGAAGCCCAAGAGGCAAGGAGG + Intronic
1163825143 19:19519300-19519322 CAGAAGGACCTCAGGCCTGGAGG + Intronic
1164169398 19:22711546-22711568 CAGAATGGCTTGAGCCTAGGAGG - Intergenic
1164540769 19:29120044-29120066 CAGCAGGACCAGAGGCATGGAGG + Intergenic
1164775790 19:30852591-30852613 CAGAAGGACTTGAGGATATAAGG + Intergenic
1165174828 19:33921115-33921137 GAGGAGCACTTGAGCCAAGGAGG - Intergenic
1165768563 19:38365358-38365380 GAGAATCACTTGAGCCAAGGAGG - Intronic
1165996697 19:39848745-39848767 CAGAGGGAGTTGAGGAAATGGGG - Intergenic
1166069591 19:40379344-40379366 CAGAAGGACAGCAGGAAAGGGGG - Exonic
1166081567 19:40446837-40446859 GAGAATGGCTTGAGGCCAGGAGG - Intergenic
1166320811 19:42017817-42017839 CAGGAGGGCGTGAGGAAAGGAGG + Intronic
1166529811 19:43535397-43535419 CAGAAGGACTTGGGGCAGTCGGG - Exonic
1166561505 19:43735523-43735545 CAGAAGCACTTGAACCTAGGAGG + Intronic
1167167525 19:47809368-47809390 GAGAATGGCTTGAGCCAAGGAGG - Intronic
1167723458 19:51195060-51195082 CAGAACGTCTTGCAGCAAGGGGG - Intergenic
1167770573 19:51513088-51513110 CAAAAAGTCTTGGGGCAAGGGGG - Intergenic
1167891410 19:52542737-52542759 CAGGAAGACTTGAAGCAGGGAGG + Intronic
1167922402 19:52792623-52792645 CAGAAGGACTTGAAGCAGCGAGG - Intronic
1168099980 19:54136235-54136257 CAGAATGGTCTGAGGCAAGGGGG - Intergenic
1168238376 19:55077473-55077495 CTGAAGGTCTTATGGCAAGGAGG + Intronic
925196786 2:1932192-1932214 CACAGGGAATTGAGGCACGGAGG + Intronic
926138587 2:10355020-10355042 CAGAAGGACAGGAAGCAAAGTGG + Intronic
926425616 2:12736269-12736291 CAGAAGGACTGGGGTCAAGCAGG + Intronic
926425727 2:12737006-12737028 CAGAAGGACTGGGGCCAAGCTGG + Intronic
926853437 2:17226482-17226504 CGGAAGGCCTTGAGCCCAGGAGG + Intergenic
927582649 2:24267642-24267664 CAGAATCACTTGAGCCCAGGAGG - Intronic
927774520 2:25892121-25892143 GAGAATTACTTGAGGCCAGGAGG - Intergenic
927877508 2:26668643-26668665 CAGAATCACTTGAGCCCAGGAGG + Intergenic
928858087 2:35824216-35824238 CAGGAAGACTTGAAGCAGGGAGG + Intergenic
929311506 2:40431396-40431418 ATGAAGGACTGTAGGCAAGGAGG + Intronic
929654491 2:43717039-43717061 GAGAAGGACATGGGGCCAGGAGG + Intronic
930672545 2:54166361-54166383 CTCAAGGACTTGAGGAAAGATGG + Intronic
930806583 2:55496428-55496450 GAGAATGACTTGAGCCCAGGAGG + Intergenic
931251925 2:60539363-60539385 GGGAAGGATTTGAGGCATGGGGG - Intronic
931348008 2:61464227-61464249 GAGAATCACTTGAAGCAAGGAGG + Intronic
931816564 2:65909085-65909107 CAGAAAGACTTGAGGACAGCAGG + Intergenic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
933537200 2:83590924-83590946 GAGAATGACTTGAGCCCAGGAGG + Intergenic
934713120 2:96528336-96528358 CAGAAGGAGGGAAGGCAAGGGGG + Intergenic
935663470 2:105489212-105489234 CAGAAGGAAGGGAGGCAGGGAGG + Intergenic
936273870 2:111074682-111074704 AAGAATGACTTGAGCCCAGGAGG - Intronic
936477169 2:112849326-112849348 CAGAACAACTTGAAGCAGGGAGG - Intergenic
937117669 2:119420203-119420225 GAGAAGGACATGAGACATGGGGG - Intergenic
937288514 2:120767921-120767943 CAGAAGGACTCGATGCCTGGTGG + Intronic
937319784 2:120954273-120954295 CGGAAGGTTTTGAGGGAAGGTGG + Intronic
937531876 2:122838514-122838536 CAGGTGGTCTTGAGGCAAAGTGG - Intergenic
937828421 2:126392991-126393013 CAGAAGGCCCTGAGCAAAGGAGG + Intergenic
939799238 2:146688030-146688052 AAGGATGGCTTGAGGCAAGGAGG - Intergenic
939984714 2:148817976-148817998 CAGAAAGACTTTAAGCAATGGGG - Intergenic
940854736 2:158721165-158721187 CAGAAGCACTTGGGGGAGGGTGG - Intergenic
941892784 2:170598951-170598973 TGAAAGGACTTGAGGCAAAGAGG - Intronic
942440196 2:176026222-176026244 CAGAAGAAATTCAGTCAAGGAGG + Intergenic
942487901 2:176458512-176458534 CAGAGGGACTTGAGGGTAAGTGG - Intergenic
942593204 2:177567826-177567848 CAGAAGGAAGTCAGGAAAGGTGG - Intergenic
943213723 2:185003260-185003282 AAGGATCACTTGAGGCAAGGAGG + Intergenic
943297555 2:186157499-186157521 GAGAATCACTTGAGCCAAGGAGG + Intergenic
945066920 2:205955328-205955350 GAGAATGACTTGAGCCCAGGGGG + Intergenic
945469341 2:210209581-210209603 GAGAATCACTTGAGCCAAGGAGG - Intronic
946084165 2:217154363-217154385 TAGAAGGACTTGAGGCAACAAGG - Intergenic
1169472388 20:5898042-5898064 CAGAATCACTTGAGGCCAGGAGG + Intergenic
1170387132 20:15831713-15831735 CACAAGGTCCTGAGGCCAGGAGG - Intronic
1171464810 20:25320000-25320022 CTGAAGGGGTTGAGGGAAGGCGG - Intronic
1172084185 20:32366445-32366467 CAGAAGGACTAAAGGAAATGAGG + Exonic
1172222906 20:33285998-33286020 CAGAGGGACCTGAGGCAGAGGGG - Intronic
1172404464 20:34677227-34677249 CAGAAAGCCTTGCGGCGAGGCGG + Intergenic
1172455569 20:35069849-35069871 AAGAAGCACTTGAGCCACGGAGG + Intronic
1173190559 20:40872554-40872576 CAGAAGGACATGAGGAAAGGTGG - Intergenic
1173821654 20:46023503-46023525 GGGAAGGACTGGAGGCAGGGAGG - Intronic
1173854019 20:46238146-46238168 CTGAAGGACTAGAGGAAAGCAGG - Intronic
1174404535 20:50294812-50294834 CAGAAGGCCTTGGGGCCAAGGGG + Intergenic
1174798050 20:53539091-53539113 AAGAATGACTTGAGCCCAGGAGG - Intergenic
1175098128 20:56558336-56558358 CAGGAGCACTTGAGCCTAGGAGG - Intergenic
1175157255 20:56979445-56979467 CAGAAGGACTGAAGGCAGTGTGG + Intergenic
1175480882 20:59309906-59309928 CAGAGGGACTTGAGGCTGGAAGG + Intronic
1175723637 20:61302583-61302605 CAGGATGACTTGAGGGATGGAGG - Intronic
1177492173 21:21841361-21841383 GAGAATGACTTGAACCAAGGAGG - Intergenic
1179095601 21:38311795-38311817 AAGAAGGATTTGTGGCAAGCTGG + Intergenic
1179124245 21:38577456-38577478 CAGAGGGACTTTAGGCCTGGGGG - Intronic
1179658881 21:42862297-42862319 CAGAAGGACTCGATGCTATGGGG + Exonic
1179711661 21:43267168-43267190 CTGAAGGACCTGAGGCCAAGAGG - Intergenic
1179906459 21:44425636-44425658 CAGGAAGACGTGACGCAAGGCGG - Intronic
1180066940 21:45417304-45417326 CAGAAGGAGGTAAGGCAAGCCGG - Intronic
1180790988 22:18575422-18575444 AATAAGGACTTGAGGGGAGGCGG + Intergenic
1180889411 22:19275292-19275314 CAGCAGGCCCTCAGGCAAGGGGG + Intronic
1181230747 22:21419892-21419914 AATAAGGACTTGAGGGGAGGCGG - Intronic
1181247900 22:21514977-21514999 AATAAGGACTTGAGGGGAGGCGG + Intergenic
1181408188 22:22699944-22699966 CAGAAGGACTTGGTGGAACGAGG + Intergenic
1181413506 22:22743253-22743275 CAGAAGGACTTGGTGGAACGAGG + Intronic
1181840211 22:25651420-25651442 CAGATGGACTTCATGCAAGTTGG + Intronic
1181897190 22:26120689-26120711 CAGAAGGACTTGGGGTAGGCAGG - Intergenic
1182025175 22:27112358-27112380 CAGAAGGAGTTCAAGCAATGTGG - Intergenic
1182713043 22:32334507-32334529 CAGCAGGAATGGAGGCAGGGAGG - Intergenic
1182891494 22:33822606-33822628 GAGAATGACTTGAGCCCAGGAGG + Intronic
1182975244 22:34617955-34617977 GAGGATGACTTGAGGCCAGGAGG + Intergenic
1183488674 22:38105115-38105137 CGGAGGGTCTTGAGCCAAGGAGG - Intronic
1184400304 22:44270072-44270094 CAGCAGGAATGGAGGCAGGGAGG - Intronic
1184445515 22:44544773-44544795 CAGCAGGACATGGGGCTAGGGGG - Intergenic
1184482230 22:44754443-44754465 GAGAAGCACTTGAACCAAGGAGG - Intronic
1184485590 22:44776878-44776900 CAGTGGGCCTTGAGGCAGGGGGG - Intronic
1184930394 22:47676948-47676970 CAGAAGGTCTGGAGGCTTGGGGG - Intergenic
1185133303 22:49052843-49052865 CAGAAGGCCCTGAGCCCAGGCGG - Intergenic
949515352 3:4802410-4802432 AGGAGGGACTAGAGGCAAGGAGG + Intronic
949952826 3:9243237-9243259 CAGAAGTATTTGAGGCAAATAGG + Intronic
950980757 3:17302110-17302132 CAGAAGCAGGAGAGGCAAGGAGG - Intronic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951841803 3:27042675-27042697 CAGGACAATTTGAGGCAAGGAGG + Intergenic
951892636 3:27581338-27581360 CAGAATCACTTGAGCCCAGGAGG + Intergenic
953484202 3:43279507-43279529 GAGAATTACTTGAGGCCAGGAGG - Intergenic
954756895 3:52845562-52845584 GAGAAGTCCTTGGGGCAAGGAGG + Intronic
955202439 3:56863061-56863083 AAGAAGGACTTGAAGAAAGATGG + Intronic
955390894 3:58521508-58521530 CAGAAGGCCTGGAGACAAGTGGG - Intronic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
956129381 3:66039344-66039366 CAGTGGGACCTGCGGCAAGGGGG - Intergenic
959340403 3:105122327-105122349 CAGAGGGACCTGATGCAAAGAGG + Intergenic
960233421 3:115254868-115254890 CAGGGGGATTTGAGGCAGGGAGG + Intergenic
960635418 3:119780359-119780381 CCTAAGGACTTCTGGCAAGGTGG + Intergenic
960813687 3:121651524-121651546 GAGAAGCACTTGAGCCCAGGGGG - Intronic
961767686 3:129224499-129224521 GAGGATGACTTGAGGCCAGGAGG + Intergenic
962000216 3:131287698-131287720 TTGAAGGACTTGTGGCAAGTAGG - Intronic
962369040 3:134805527-134805549 CAGGAGGGCAGGAGGCAAGGTGG - Intronic
962896707 3:139721991-139722013 CAGAGGCACATGAGGCATGGGGG + Intergenic
962911076 3:139850285-139850307 AAGAATGACTTGAGCCTAGGAGG - Intergenic
965954187 3:174348519-174348541 GAGAATCACTTGAGGCTAGGAGG + Intergenic
968295624 3:197574521-197574543 CAGAATAACTTGAAGCAGGGAGG + Intergenic
968943587 4:3652107-3652129 CAGAAGCACAAGGGGCAAGGTGG - Intergenic
969069486 4:4523719-4523741 GAGAAGGACTGGCAGCAAGGAGG - Intronic
971408353 4:26343838-26343860 CAGAATCACTTGAGCCCAGGAGG - Intronic
971419076 4:26459255-26459277 CGTAAAGACTTGAGGCCAGGCGG - Intergenic
971971179 4:33622868-33622890 CAGAGGGACTCGTGGAAAGGTGG + Intergenic
972797720 4:42438667-42438689 CAGATGGACTGAATGCAAGGAGG + Intronic
973902329 4:55488823-55488845 CAGGAGGACTTGAGCCTAGGAGG - Intronic
976490047 4:85659997-85660019 CAGTAGGACTTGTTGCTAGGGGG + Intronic
977898139 4:102386904-102386926 AAGAAAGACTTGAAGGAAGGTGG - Intronic
978901532 4:113956037-113956059 AAGGATCACTTGAGGCAAGGAGG - Intronic
979032421 4:115666302-115666324 AAGAAGGAAGGGAGGCAAGGAGG - Intergenic
979383397 4:120035379-120035401 CAGAAGGCCTTGAGGCTCAGAGG - Intergenic
980045164 4:127979824-127979846 GAGAATCACTTGAGCCAAGGAGG + Intronic
980482536 4:133405486-133405508 CACCAGGATTTAAGGCAAGGAGG - Intergenic
980876050 4:138663368-138663390 GAGAAGGTCTTTAGGCAAGAGGG - Intergenic
981406489 4:144375759-144375781 AAGAAAGAAGTGAGGCAAGGGGG + Intergenic
981510572 4:145552992-145553014 CAGGATTGCTTGAGGCAAGGAGG - Intronic
982920330 4:161266589-161266611 CAGGACGACTTGAAGCAGGGAGG + Intergenic
984170641 4:176354814-176354836 CAGAATCACTTGAATCAAGGAGG + Intergenic
984233793 4:177131981-177132003 CAGAAAGACTTGACCCATGGAGG + Intergenic
984744312 4:183199158-183199180 AAGCAGGACTTGAGGAAAGCAGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986648408 5:9940727-9940749 CTGTAGGACTTCAGGCAAGTTGG - Intergenic
986695089 5:10344690-10344712 CAGAAGTACTTGAGCCCAGGAGG + Intergenic
986828823 5:11551976-11551998 CAGGATCACTTGAGGCCAGGGGG - Intronic
986986536 5:13506708-13506730 CTGAAGGAGTTCAGGCAAGAGGG + Intergenic
987020137 5:13861861-13861883 CAGAATCACTTGAGCCAGGGAGG + Intronic
987106403 5:14644058-14644080 CAGAATGACTTGAACCCAGGAGG - Intergenic
987265768 5:16253455-16253477 CAGAACGACTTGAACCATGGTGG + Intergenic
988401280 5:30763472-30763494 GAGAATCACTTGAGGCCAGGAGG + Intergenic
988593902 5:32573654-32573676 GAGGATGACTTGAGCCAAGGAGG - Intronic
989060180 5:37403034-37403056 GAGAATGGCTTGAGGCCAGGAGG - Intronic
989169320 5:38459227-38459249 GAGAATCACTTGAGGCCAGGAGG - Intronic
990759551 5:59113104-59113126 AAGAAGGAAGTGAGGGAAGGTGG - Intronic
991142496 5:63260788-63260810 TAGAAGGACTAGAGAAAAGGAGG - Intergenic
991235006 5:64383967-64383989 TAGAAGGAAGGGAGGCAAGGAGG + Intergenic
991771607 5:70046202-70046224 GAGGAGTACTTGAGCCAAGGAGG - Intergenic
991850899 5:70921620-70921642 GAGGAGTACTTGAGCCAAGGAGG - Intergenic
992281926 5:75187367-75187389 CAGAAGTACCTGAGACAATGAGG + Intronic
992539520 5:77750755-77750777 CAGGAGGTCCTGAGGCCAGGTGG + Intronic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
997677797 5:135726464-135726486 AAGAAGGAATGGAGGCAAGAGGG - Intergenic
999185734 5:149707192-149707214 CAGAAGGGCTTGGAGCCAGGTGG - Intergenic
999285869 5:150393919-150393941 AAGAATGACTTGAAGCCAGGAGG + Intronic
999763356 5:154719770-154719792 GAGAATCACTTGAGGCCAGGAGG + Intronic
999992775 5:157064430-157064452 GAGAATGGCTTGAGCCAAGGAGG + Intergenic
1000621722 5:163493868-163493890 CATAAGTACTTGAAGGAAGGCGG - Intergenic
1001096523 5:168779728-168779750 CAGAAAGACTTGAGTCACGAGGG - Intronic
1001318211 5:170659488-170659510 CAGTAGGAATTCAGGCAATGTGG - Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001475328 5:172046268-172046290 GAGAATCACTTGAGGCGAGGTGG + Intronic
1001475682 5:172048990-172049012 CTGAAGGACCTGAGGGAGGGAGG - Intronic
1003693617 6:8379619-8379641 CAAAAGGATTTCAGGCAAGAAGG + Intergenic
1004399013 6:15271235-15271257 CAGGAGGGCTTGAGGCCAGTGGG + Intronic
1004637099 6:17479513-17479535 AAGAAGGAAAAGAGGCAAGGAGG + Intronic
1005730752 6:28694490-28694512 CAGAAGAAGTTGAGGGAAAGGGG + Intergenic
1005987978 6:30885896-30885918 GTGAAGGGCTTGAGGCAGGGTGG + Intronic
1006975011 6:38091802-38091824 CAGACGGAGCTGAGGCATGGAGG + Intronic
1007762476 6:44141116-44141138 CAGCAGGGCTTGAGGGTAGGGGG - Intronic
1008262099 6:49379346-49379368 TATAATCACTTGAGGCAAGGAGG + Intergenic
1008313343 6:50006362-50006384 CAGAATCACTTGAACCAAGGAGG + Intergenic
1008747536 6:54691080-54691102 AAGAATGACTTGAGCCCAGGAGG - Intergenic
1008841971 6:55913363-55913385 AGTAAGGACTTGAGCCAAGGAGG - Intergenic
1010873993 6:81078458-81078480 TAGAGGCACTTGAGGCCAGGAGG - Intergenic
1011128293 6:84029906-84029928 CAGAAGGCCAAGAGGCAGGGAGG - Intergenic
1011384937 6:86785614-86785636 CAGAATGACATGAGGCAAATGGG - Intergenic
1011582723 6:88888025-88888047 GAGAATGACTTGAGCCCAGGAGG + Intronic
1012952634 6:105535044-105535066 AAGAAGCACTTGAGCCCAGGAGG - Intergenic
1014218200 6:118773645-118773667 CAGAAGGAGTCCAGGCAAGCTGG - Intergenic
1015397276 6:132749136-132749158 CAAAAGGACATGGGTCAAGGAGG - Intronic
1016295405 6:142568016-142568038 CAAAGGGACCTGAGCCAAGGAGG + Intergenic
1017021810 6:150145880-150145902 CAGAAGAACTTGACCCAAGCAGG + Intronic
1017128206 6:151085679-151085701 GAGAATCACTTGAGGCCAGGAGG + Intronic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017536445 6:155352035-155352057 GAGAATGACTTGAGCCCAGGAGG - Intergenic
1017739294 6:157392679-157392701 TAGAAGGATTGGAGTCAAGGGGG - Intronic
1017750563 6:157487228-157487250 CAGAAGGATTTCAGGCAGGAGGG + Intronic
1018884054 6:167917455-167917477 CAGAAGGACTAGAGGAGAGGAGG + Intronic
1019165899 6:170097428-170097450 CAGACGGAAGTGAGGCAACGCGG + Intergenic
1020102535 7:5402443-5402465 GAGAATGACTTGAGCCCAGGAGG + Intronic
1020288415 7:6704136-6704158 CAGAAGCACTTGGGCCAAGCTGG - Intronic
1021525731 7:21585246-21585268 AATAAGTACTTGAGGCTAGGTGG + Intronic
1021683583 7:23159251-23159273 GAGAATCACTTGAGGCCAGGAGG - Intronic
1024098359 7:46004455-46004477 GTGAAGGACTTGAGTCAGGGAGG + Intergenic
1026784508 7:73293629-73293651 CAGAAGGGGGTGAGGAAAGGTGG + Intergenic
1026890641 7:73979807-73979829 CAGCAGGACTTGGGGCTTGGAGG + Intergenic
1027109563 7:75426299-75426321 CAGAAGGGGGTGAGGAAAGGTGG - Intronic
1027236440 7:76301060-76301082 GAGGAGCACTTGAGCCAAGGAGG - Intergenic
1027613285 7:80389767-80389789 TACTAGGACTAGAGGCAAGGTGG - Intronic
1027704883 7:81517743-81517765 GAGAACGACTTGAGCCCAGGTGG - Intergenic
1027712250 7:81619411-81619433 TAGCAGAACATGAGGCAAGGTGG + Intergenic
1028270927 7:88788180-88788202 CATGAGGACTGGAGGCCAGGTGG + Intronic
1029373960 7:100166940-100166962 TAGAAGGAGTTGGGGCAAAGTGG + Intronic
1029793703 7:102871915-102871937 GAGAAGGACTGGGGGCAGGGAGG - Intronic
1030212715 7:107012105-107012127 GAGAATGACTTGAGCCCAGGAGG - Intergenic
1032492703 7:132335845-132335867 AAAAAGGTCTTGAGACAAGGTGG - Intronic
1034468580 7:151244011-151244033 CAGAAGTGTTTGAGGAAAGGTGG + Intronic
1034823703 7:154240746-154240768 TAGCAGGACTTGAGGAAATGAGG - Intronic
1035335526 7:158125259-158125281 GGGAGGGACTTGAGGCAGGGAGG - Intronic
1035335548 7:158125319-158125341 GGGAGGGACTTGAGGCAGGGAGG - Intronic
1035616423 8:1005496-1005518 GAGAATCACTTGAGGCCAGGAGG - Intergenic
1036213543 8:6861780-6861802 CAGGAAGACTTGAAGCAGGGAGG - Intergenic
1037235817 8:16718260-16718282 CAGAATGGCTTGAGGCCAGGAGG - Intergenic
1037933783 8:22900557-22900579 CAGAATCACTTGAGCCCAGGAGG + Intronic
1038471923 8:27831261-27831283 CAGAATCACTTGAGCCCAGGAGG + Intronic
1038498475 8:28024111-28024133 CAGAAGCACTTGAGCCTGGGAGG - Intronic
1039014194 8:33127901-33127923 CTCAAGGATTTCAGGCAAGGAGG - Intergenic
1039461904 8:37752071-37752093 CAGAAGTAGCTAAGGCAAGGGGG - Intronic
1039471122 8:37814441-37814463 CAGAAGGTCTGGAGGCAGGCGGG - Intronic
1039978597 8:42387791-42387813 CAGAAAGACCTGAAGCAAGAAGG - Intergenic
1042103932 8:65304194-65304216 CAGAAGGAATTGAGGCTGCGTGG - Intergenic
1043776290 8:84273542-84273564 CACAAGGACATGATACAAGGAGG + Intronic
1044637135 8:94337211-94337233 GAGAATCACTTGAGGCCAGGAGG + Intergenic
1045351910 8:101349141-101349163 CTGAAGGACTTGGAGAAAGGAGG - Intergenic
1045680057 8:104649364-104649386 CAGAAGCATTTAAGGCAAGTTGG - Intronic
1046312385 8:112454938-112454960 GAAAATGACTTGAGCCAAGGAGG + Intronic
1048231439 8:132645480-132645502 GAGAATGACTTTAGGCAAAGTGG + Intronic
1048292822 8:133193386-133193408 CAGAAGGAGATCAGCCAAGGAGG + Intronic
1049493657 8:142918020-142918042 CAGCAGGACTTGCAGCAATGGGG - Intergenic
1049702431 8:144021268-144021290 GAGAGGGACCTGAGGGAAGGGGG - Intronic
1050191219 9:3028670-3028692 CAGAACAACCTGAGCCAAGGGGG + Intergenic
1051054666 9:12970823-12970845 CAGATGGAATTGAAGCAAGGTGG - Intergenic
1051203624 9:14660274-14660296 GAGAATCACTTGAGGCCAGGAGG + Intronic
1051326508 9:15977028-15977050 CAGGAGGACTGGAGGAATGGAGG - Intronic
1052861325 9:33439654-33439676 CAGAAGGACATGGGGCATGCTGG + Intergenic
1054313031 9:63548795-63548817 CAGAAAGACTTGCTGAAAGGTGG - Intergenic
1055115927 9:72605663-72605685 GAGAAGAACTTGAGCCAGGGAGG - Intronic
1055275344 9:74609701-74609723 CAGAAGAAATTGAGGCACAGAGG + Intronic
1056712169 9:88999910-88999932 CAGAAGCACTTGAACCCAGGAGG + Exonic
1057349383 9:94282429-94282451 CGGAACAACTTGAAGCAAGGCGG + Intronic
1057725712 9:97566579-97566601 GAGAAGCACTTGAGCCCAGGAGG + Intronic
1059136184 9:111808635-111808657 CAGGAAGACTTGAAGCAGGGAGG - Intergenic
1060270263 9:122135169-122135191 CAGGGGGTTTTGAGGCAAGGTGG - Intergenic
1060439795 9:123627802-123627824 CACAAAGACTTGAAGCAAGGAGG + Intronic
1060520777 9:124292724-124292746 CAGAAACACCTGAGGCCAGGAGG - Intronic
1060531146 9:124347640-124347662 CAGAAGGACTAGAGAGGAGGAGG - Intronic
1060865112 9:126989279-126989301 CAGAAGAGGTTGAGGCATGGGGG + Intronic
1061876768 9:133547886-133547908 TAGAAGAACTTGTGGCAAGTCGG - Intronic
1187114179 X:16332396-16332418 CAGAATCACTTGAGCCCAGGAGG - Intergenic
1187914132 X:24137432-24137454 GAGGATGACTTGAGCCAAGGAGG + Intergenic
1189843911 X:45114249-45114271 GAGAATGGCTTGAGCCAAGGAGG - Intergenic
1190052540 X:47161618-47161640 GAGAATCACTTGAGGCCAGGAGG - Intronic
1190639969 X:52474902-52474924 CAGAAGGACATGGGGGAAGAAGG + Intergenic
1190647703 X:52537963-52537985 CAGAAGGACATGGGGGAAGAAGG - Intergenic
1190772175 X:53524313-53524335 CAGAAGGATTTAAGGCAGGAAGG + Intergenic
1190781190 X:53597386-53597408 CAGAAGGATTTAAGGCAGGAAGG + Intronic
1192166931 X:68832327-68832349 CAAAAGGACTTGAGAAAAAGAGG - Intronic
1192184038 X:68934500-68934522 CCCAAGGACTTCAGGCATGGAGG - Intergenic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1192427289 X:71088616-71088638 CAGAATGGCTTGAGCCCAGGAGG - Intergenic
1192708428 X:73553167-73553189 CAGAAGTAATTGAGGCCAGGAGG + Intergenic
1193102812 X:77635193-77635215 GAGAATCACTTGAGGCCAGGAGG + Intronic
1194350761 X:92823144-92823166 CAGGAGAACTTGAGGCAGGTTGG + Intergenic
1194466568 X:94240995-94241017 CTGGAGGAGTTGAGGCAAGATGG - Intergenic
1197068928 X:122270053-122270075 TAGAATGGCTTGAGGAAAGGAGG - Intergenic
1197870473 X:131058541-131058563 CAGCAGGAAGGGAGGCAAGGGGG - Intronic
1198432209 X:136578779-136578801 CAGAACAACTTGGGGCAAGTAGG + Intergenic
1198627243 X:138590673-138590695 CAAAAGGAAGTCAGGCAAGGTGG - Intergenic
1198744672 X:139877558-139877580 CAGAAGCAATTTAGGGAAGGGGG + Intronic
1200540854 Y:4453976-4453998 CAGAAGGCAAGGAGGCAAGGAGG - Intergenic
1200659088 Y:5939824-5939846 CAGGAGAACTTGAGGCAGGTTGG + Intergenic
1201914501 Y:19167798-19167820 CAGGATCACTTGAGCCAAGGAGG + Intergenic