ID: 912204164

View in Genome Browser
Species Human (GRCh38)
Location 1:107492319-107492341
Sequence CTGGTGACACAGCTGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912204156_912204164 16 Left 912204156 1:107492280-107492302 CCACTCTCCACATGACCTGAGTG No data
Right 912204164 1:107492319-107492341 CTGGTGACACAGCTGCAGAGAGG No data
912204161_912204164 -7 Left 912204161 1:107492303-107492325 CCTACACCTAGCCTGGCTGGTGA No data
Right 912204164 1:107492319-107492341 CTGGTGACACAGCTGCAGAGAGG No data
912204158_912204164 1 Left 912204158 1:107492295-107492317 CCTGAGTGCCTACACCTAGCCTG No data
Right 912204164 1:107492319-107492341 CTGGTGACACAGCTGCAGAGAGG No data
912204157_912204164 9 Left 912204157 1:107492287-107492309 CCACATGACCTGAGTGCCTACAC No data
Right 912204164 1:107492319-107492341 CTGGTGACACAGCTGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912204164 Original CRISPR CTGGTGACACAGCTGCAGAG AGG Intergenic
No off target data available for this crispr