ID: 912207477

View in Genome Browser
Species Human (GRCh38)
Location 1:107524343-107524365
Sequence CACCCTGAGCAGGCTCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912207477_912207480 27 Left 912207477 1:107524343-107524365 CCTCTCAGAGCCTGCTCAGGGTG No data
Right 912207480 1:107524393-107524415 CTTCCTCATGAATGTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912207477 Original CRISPR CACCCTGAGCAGGCTCTGAG AGG (reversed) Intergenic
No off target data available for this crispr