ID: 912207593

View in Genome Browser
Species Human (GRCh38)
Location 1:107525557-107525579
Sequence CTCTCTGAATAATAAGCGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912207593_912207594 -8 Left 912207593 1:107525557-107525579 CCATACGCTTATTATTCAGAGAG No data
Right 912207594 1:107525572-107525594 TCAGAGAGTGTATACACAGATGG No data
912207593_912207600 15 Left 912207593 1:107525557-107525579 CCATACGCTTATTATTCAGAGAG No data
Right 912207600 1:107525595-107525617 AAGTTGGGGTAAGTTGCATGGGG No data
912207593_912207596 0 Left 912207593 1:107525557-107525579 CCATACGCTTATTATTCAGAGAG No data
Right 912207596 1:107525580-107525602 TGTATACACAGATGGAAGTTGGG No data
912207593_912207598 13 Left 912207593 1:107525557-107525579 CCATACGCTTATTATTCAGAGAG No data
Right 912207598 1:107525593-107525615 GGAAGTTGGGGTAAGTTGCATGG No data
912207593_912207595 -1 Left 912207593 1:107525557-107525579 CCATACGCTTATTATTCAGAGAG No data
Right 912207595 1:107525579-107525601 GTGTATACACAGATGGAAGTTGG No data
912207593_912207597 1 Left 912207593 1:107525557-107525579 CCATACGCTTATTATTCAGAGAG No data
Right 912207597 1:107525581-107525603 GTATACACAGATGGAAGTTGGGG No data
912207593_912207599 14 Left 912207593 1:107525557-107525579 CCATACGCTTATTATTCAGAGAG No data
Right 912207599 1:107525594-107525616 GAAGTTGGGGTAAGTTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912207593 Original CRISPR CTCTCTGAATAATAAGCGTA TGG (reversed) Intergenic
No off target data available for this crispr