ID: 912207595

View in Genome Browser
Species Human (GRCh38)
Location 1:107525579-107525601
Sequence GTGTATACACAGATGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912207593_912207595 -1 Left 912207593 1:107525557-107525579 CCATACGCTTATTATTCAGAGAG No data
Right 912207595 1:107525579-107525601 GTGTATACACAGATGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912207595 Original CRISPR GTGTATACACAGATGGAAGT TGG Intergenic
No off target data available for this crispr