ID: 912210442

View in Genome Browser
Species Human (GRCh38)
Location 1:107551173-107551195
Sequence TAGAATTATTCCAATGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912210437_912210442 18 Left 912210437 1:107551132-107551154 CCTACTGATGGACTAGATGTTCC No data
Right 912210442 1:107551173-107551195 TAGAATTATTCCAATGGGTTTGG No data
912210439_912210442 -3 Left 912210439 1:107551153-107551175 CCATATAAAAGAGAGGAATCTAG No data
Right 912210442 1:107551173-107551195 TAGAATTATTCCAATGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912210442 Original CRISPR TAGAATTATTCCAATGGGTT TGG Intergenic
No off target data available for this crispr