ID: 912210827

View in Genome Browser
Species Human (GRCh38)
Location 1:107555019-107555041
Sequence GCCACAAGAGTGTTTGTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912210827_912210831 25 Left 912210827 1:107555019-107555041 CCCGTGACAAACACTCTTGTGGC No data
Right 912210831 1:107555067-107555089 AATTTCAATGCTAAATTTCAGGG No data
912210827_912210829 -1 Left 912210827 1:107555019-107555041 CCCGTGACAAACACTCTTGTGGC No data
Right 912210829 1:107555041-107555063 CTTTGTCTTTGTGTACATCTAGG No data
912210827_912210830 24 Left 912210827 1:107555019-107555041 CCCGTGACAAACACTCTTGTGGC No data
Right 912210830 1:107555066-107555088 AAATTTCAATGCTAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912210827 Original CRISPR GCCACAAGAGTGTTTGTCAC GGG (reversed) Intergenic
No off target data available for this crispr