ID: 912212739

View in Genome Browser
Species Human (GRCh38)
Location 1:107572389-107572411
Sequence GTGTGTGCGGGGGAGGTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1542
Summary {0: 1, 1: 0, 2: 6, 3: 169, 4: 1366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912212731_912212739 -7 Left 912212731 1:107572373-107572395 CCCAGGTCATCTTTGTGTGTGTG 0: 1
1: 0
2: 10
3: 159
4: 952
Right 912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG 0: 1
1: 0
2: 6
3: 169
4: 1366
912212729_912212739 24 Left 912212729 1:107572342-107572364 CCAAGAAAATGTGGGAATAAAAA 0: 1
1: 0
2: 5
3: 86
4: 896
Right 912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG 0: 1
1: 0
2: 6
3: 169
4: 1366
912212732_912212739 -8 Left 912212732 1:107572374-107572396 CCAGGTCATCTTTGTGTGTGTGC 0: 1
1: 1
2: 1
3: 39
4: 567
Right 912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG 0: 1
1: 0
2: 6
3: 169
4: 1366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912212739 Original CRISPR GTGTGTGCGGGGGAGGTGGA TGG Exonic
900009894 1:96428-96450 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900026006 1:273012-273034 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900035790 1:406869-406891 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900057412 1:642619-642641 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
900098890 1:952640-952662 GAGTGGGCGGTGGAGGTGCATGG - Intronic
900105392 1:978834-978856 GTGTGTGCCTGGGATCTGGACGG + Intronic
900110683 1:1004250-1004272 GTGTGTGAGGGGGGTGTTGAGGG - Intergenic
900180685 1:1309713-1309735 GTGTGTGCCGAGGAGGTGCTGGG - Exonic
900323523 1:2096248-2096270 GTGTGTGCCTGGGAGGCGCACGG + Intronic
900581411 1:3411707-3411729 GTGAGTGCGGGGAACGTGGGAGG - Exonic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
900768411 1:4520789-4520811 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768442 1:4520933-4520955 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900793484 1:4694055-4694077 GGGTGTGCTGGGCAGGTGCAGGG - Intronic
900834123 1:4986870-4986892 GTGTCTGTGGGGGATGGGGAGGG - Intergenic
900938890 1:5784928-5784950 GTGTGTGTGGGGGGGGGGGTGGG + Intergenic
901053534 1:6437863-6437885 GTGTGTGAGAGGGAGGGAGAGGG + Intronic
901142003 1:7041048-7041070 GTGTGGGCGCAGGAGGCGGAGGG + Intronic
901179982 1:7335132-7335154 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
901179984 1:7335134-7335156 GTGTGTGGGGGGGGGGGGGGGGG + Intronic
901293692 1:8144595-8144617 GTGTGTGTGTGTGAGATGGATGG + Intergenic
901689285 1:10962060-10962082 GTCTGTGAGGAGGAGGAGGAAGG - Intronic
902239908 1:15081584-15081606 GTGTGTGTTGGGGAGTTGTAGGG + Intronic
902361176 1:15943374-15943396 GTGGGTGTGGGGGAGGGGGCAGG + Intronic
902393270 1:16118667-16118689 ATGTGTGCGGGGGTGGGCGAGGG + Intergenic
902480741 1:16710281-16710303 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
902520335 1:17012018-17012040 GTGTGTGCGGAGGAGCAGGCGGG - Intergenic
902535121 1:17115287-17115309 GTCTGTGAGGTGGAGGTGGGAGG - Intronic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903265151 1:22153741-22153763 ATGTGTGTTGGGGAGGTGGATGG + Intergenic
903297140 1:22350947-22350969 GTGGGGGCGGGGGAGGGGGCAGG - Intergenic
903471463 1:23590613-23590635 GTGTGGGAGGGTGAGGTTGATGG - Intronic
903622460 1:24707813-24707835 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
903622462 1:24707815-24707837 GTGTGTGGGGGGGGGGGGGGGGG + Intergenic
903852489 1:26316476-26316498 GTTTGTGTAGGGGAGGGGGAGGG + Intronic
903866062 1:26398706-26398728 GGGTGTGGGGGGCAGGGGGAGGG + Intergenic
903974395 1:27139647-27139669 GTGTTTGGGGGTGAGGTGGAAGG + Intronic
904043668 1:27598292-27598314 GTGTGTGTGGTGGAGGGGGCTGG + Intronic
904115734 1:28160556-28160578 GTGTGTGTGTGGGGGGTGGCGGG - Intronic
904770438 1:32878237-32878259 GTGTGTGTTTGGGAGGAGGAAGG + Intergenic
904947976 1:34213248-34213270 TTCTGTGATGGGGAGGTGGAAGG - Intronic
905198479 1:36299922-36299944 GTGTGTGTGGGTGAGGAGCAGGG + Intronic
905548901 1:38820200-38820222 GTGTGTGTGGAGGTGGTGGGAGG - Intergenic
906035519 1:42748177-42748199 GTGAGTGCGGGGCAGGTGCAGGG - Intronic
906038112 1:42766008-42766030 GTGTGTGTGGGGGCGGGGGGGGG - Intronic
906048308 1:42850239-42850261 GTGTGGGCGGGGGGTGTGGGTGG + Intronic
906103028 1:43275200-43275222 GTGTGTGCATGGCAGGGGGAAGG - Intergenic
906466648 1:46087116-46087138 GTGTGTGGGGGAATGGTGGAGGG + Intronic
906547722 1:46633131-46633153 GTGTGTGGGGGGGTGGTGTACGG + Exonic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
907052812 1:51341179-51341201 GTGTGTGGGCGGGGGGTGGGGGG - Intronic
907372620 1:54013045-54013067 GTGTGTGTGGGGGAGGCGGCGGG + Intronic
907470732 1:54671805-54671827 GTGAGTGTGGGGGAGATGGATGG + Intronic
907474432 1:54695971-54695993 GTGTGTGTTGGGGAGGTGCTAGG + Intronic
907637221 1:56147641-56147663 GTGTGTGTGGGTGGGGTGGAGGG + Intergenic
907810318 1:57863266-57863288 GTGTGTATGGGGGATGTGTAAGG + Intronic
908096722 1:60746855-60746877 GTGGGGGCGGGGCAGGGGGATGG + Intergenic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
908258600 1:62321795-62321817 GTGTGGGGTGGGGAGGTGGGGGG - Intergenic
908325999 1:63024352-63024374 GTGTGTGGGGAGGGAGTGGAGGG + Intergenic
908328894 1:63051078-63051100 GTGTGTACGGGGGTTGGGGACGG + Intergenic
908389928 1:63675240-63675262 GTGTGGGAGGGGGAGAGGGAAGG - Intergenic
908486296 1:64597079-64597101 GTGAGTGGGGGGGTGCTGGAGGG + Intronic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
909339789 1:74519024-74519046 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
909395802 1:75169490-75169512 GAGTGGGCGGTGGAGGTGGGTGG + Intergenic
909622999 1:77687158-77687180 GGGCGTGGGGGGGGGGTGGAGGG - Intergenic
909958183 1:81802768-81802790 GCGAGTTCGGGGGAAGTGGACGG + Intronic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
910621430 1:89259826-89259848 GTGTGTGCGGGGGTGTCGGGGGG - Intronic
910771921 1:90839569-90839591 GTGGGTGTGTGGGAGGAGGAGGG + Intergenic
911209974 1:95128757-95128779 GTGTGTGTGGTGGGGGTGGCAGG + Intronic
911522090 1:98941414-98941436 GTGTGTGTTGTGGAGGTGGAAGG + Intronic
911590936 1:99746898-99746920 GGGTGGGTGGAGGAGGTGGAAGG - Intronic
911827894 1:102511170-102511192 TTGTGGGGGGGGGAGGTGGGAGG - Intergenic
912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG + Exonic
912655795 1:111485437-111485459 TTGTGTGCTGGGGAGGTAGGTGG + Intronic
912660597 1:111526173-111526195 GTGTGTGGTGGGGAGGTAGAGGG - Intronic
912734582 1:112139122-112139144 GTGTGGGTTGAGGAGGTGGATGG + Intergenic
912910929 1:113758942-113758964 GTGGGTGCGGGGGAGGGGCAGGG + Intronic
913326996 1:117636015-117636037 GAGTGGGCTGGGGAGCTGGATGG + Intergenic
913533196 1:119747720-119747742 GTGGGGGCAGGGGAGGAGGAGGG - Intergenic
913715734 1:121532375-121532397 GTGGGTTCGGGGGAGGGGGGAGG - Intergenic
913732936 1:121736403-121736425 GTGGGGTCGGGGGAGGTGGGAGG + Intergenic
913769275 1:122229722-122229744 GTGGGGTCGGGGGAGGTGGGAGG + Intergenic
914598036 1:149174003-149174025 GTGGGTTGGGGGGAGGTGGGAGG - Intergenic
914866508 1:151434389-151434411 GTTTGAGCCTGGGAGGTGGAGGG + Intronic
915007808 1:152656184-152656206 GTGTGTGTGGGGGAGGGTGGGGG + Intergenic
915082217 1:153360051-153360073 GTGTGGGCAGGGGAGATGGAGGG - Intronic
915269303 1:154742291-154742313 GTGTGTGGGCAGTAGGTGGATGG - Intronic
915287735 1:154863497-154863519 GTGTGTGCGGGGGTTGTGAGGGG - Intronic
915567146 1:156721515-156721537 GTGTGTCAGGGGGAGTTGCATGG + Intergenic
915635771 1:157185520-157185542 GTGTGTGGTGAGCAGGTGGAAGG - Intergenic
915700190 1:157784748-157784770 TTGTGTGAGGGGGAGGATGAAGG - Intergenic
915852699 1:159343045-159343067 GTGTGTGGGGGGGGGGCGGGCGG + Intergenic
915893483 1:159792550-159792572 GTGTGTGTGTGGGAGGAGGGTGG - Intergenic
915925855 1:160019074-160019096 GTGTGTATGGGGGTGGCGGATGG - Intergenic
916051885 1:161042174-161042196 GTGTCTGAGGGGCAGCTGGATGG - Exonic
916092462 1:161318267-161318289 TTATATGCGGGGGAGGGGGAAGG - Intronic
916243825 1:162666571-162666593 GTGTGTGGGGGAAAGGGGGAGGG + Intronic
916970380 1:170007186-170007208 GTGTTTGTGTGGGAGGTGAAGGG + Intronic
917002602 1:170375944-170375966 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
917121811 1:171651337-171651359 GTGTGTGTGGGGGGGGTGCGGGG - Intronic
917781215 1:178399367-178399389 GGGTGGGCGGGGGAGGGGCAGGG + Intronic
917796709 1:178538099-178538121 GGGTGTGAGGGGGAGATGCAGGG + Intronic
917991931 1:180389146-180389168 TTGTGGGCGGGGGAGCGGGAAGG - Intronic
918128272 1:181603552-181603574 GTGTTGGCGGGGGCGGGGGAGGG - Intronic
918329029 1:183438503-183438525 TTGTGTGTGGGGGGGGGGGAGGG - Intergenic
918433222 1:184483905-184483927 GTGTGTGGGGCGGGGGTGGGGGG + Intronic
918881126 1:190122579-190122601 GTGGGGGTGGGGGAGGGGGAGGG + Intronic
919422685 1:197390175-197390197 TTGTGTGGGGGGGAGGGGGTGGG + Intronic
919790115 1:201285213-201285235 GTGTGTGTGTGTGTGGTGGAAGG - Intronic
920035008 1:203059991-203060013 GTGTGTGTTGGGGAGGGGGAGGG - Intronic
920249140 1:204610955-204610977 GAGTATGTGGTGGAGGTGGAGGG + Intergenic
920534843 1:206730766-206730788 GAGTGTGCTGGGGAGGGGGCTGG + Intronic
921324913 1:213980286-213980308 GGGGGCGCGGGGGAGGTGGGTGG - Intergenic
921324939 1:213980363-213980385 GTGTGTGTGTGGGAGGGGCAAGG - Intergenic
921326685 1:213991411-213991433 GTGTGTGTTTGGGAGGTGGGGGG - Intronic
922127062 1:222738038-222738060 GTGTGTGTTGGGGGGATGGAGGG + Intronic
922244216 1:223778924-223778946 GGGTGGGCGGGGCAGGTGGGTGG - Intergenic
922258324 1:223912435-223912457 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
922412138 1:225387236-225387258 ATGTGTGGGGGGGAGGGGGAGGG + Intronic
922434807 1:225593393-225593415 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
922434809 1:225593395-225593417 GTGTGTGGGGGGGGGGGGGGGGG + Intronic
922504020 1:226115948-226115970 GAGGGGGAGGGGGAGGTGGAGGG + Intergenic
922618769 1:226978296-226978318 GTGTGTGGTGGGTGGGTGGAGGG - Intronic
922764894 1:228151593-228151615 GTGTGTGGGGGGGTGGAGGGAGG + Intronic
923015144 1:230120732-230120754 GTGTGTGCGGAGGAGGATGAGGG - Intronic
923052782 1:230400326-230400348 GAGTGTGGGGGAGGGGTGGAAGG - Intronic
923547212 1:234931583-234931605 GAGTGTGTGGGGGGAGTGGAAGG - Intergenic
923658012 1:235935079-235935101 GTGTGTGTGGGGGGGGTGTGGGG + Intergenic
924178683 1:241419141-241419163 TTGTGGGCGGGGGTGGCGGAGGG + Intergenic
924339520 1:243015199-243015221 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
924436557 1:244048607-244048629 GCGGGCGCGGGGGAGGGGGAGGG - Intergenic
924446820 1:244140598-244140620 GGGTGAGTGGGGTAGGTGGATGG - Intergenic
924609625 1:245563037-245563059 GGCTGTGCTGGGGAGGTGGCAGG - Intronic
924850286 1:247822304-247822326 GTGTGTGTGGCGGGGGGGGAGGG + Intergenic
1062811527 10:469989-470011 GTGAGAGGTGGGGAGGTGGATGG + Intronic
1062821491 10:537563-537585 AAGTGTGCGGGGGAGGGGGACGG - Intronic
1062831465 10:608486-608508 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1062831496 10:608551-608573 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
1063135201 10:3210192-3210214 GTGTGCGTGGGGGTGGTGGGCGG + Intergenic
1063154948 10:3370603-3370625 GTGGGGGCGGGGGGGGTGGAGGG - Intergenic
1063379778 10:5577168-5577190 GTGTGTGCGGGGCATGTGTGTGG - Intergenic
1063379819 10:5577365-5577387 GTGTGTGCGGGGCATGTGTGTGG - Intergenic
1063379835 10:5577433-5577455 GTGTGTGCGGGGCATGTGTGTGG - Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063482146 10:6385332-6385354 GAGTGTGAGTGGGAGGAGGAGGG - Intergenic
1063929126 10:11011407-11011429 GTGGGTGAGGGGGAGAGGGAAGG + Intronic
1064175872 10:13074566-13074588 GTGGGAGAGGGGGAGGGGGAGGG - Intronic
1064451340 10:15444844-15444866 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1065513925 10:26506243-26506265 GTGTGTGTGGGGGGGGGGGGTGG + Intronic
1065513929 10:26506247-26506269 GTGTGGGGGGGGGGGGTGGGGGG + Intronic
1065992564 10:31027091-31027113 GTGGGGTCGGGGGAGGGGGAAGG + Intronic
1066316439 10:34252106-34252128 GGGTGTGCTGGGGAGGGGGAGGG + Intronic
1066360726 10:34727807-34727829 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
1066650693 10:37652162-37652184 GTGTGTGCGCTGGAGAAGGAAGG - Intergenic
1067228333 10:44389717-44389739 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1067550520 10:47231599-47231621 GTGTGTGTAGGGGTGGTGGCTGG - Intergenic
1067570083 10:47365178-47365200 GGGTGTGAGGAGGAGATGGAGGG - Intergenic
1067616976 10:47763781-47763803 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1067711571 10:48655249-48655271 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
1067735215 10:48845318-48845340 GAGTGTGTGGGGGAGGTTGAAGG - Intronic
1067809795 10:49417891-49417913 GTGGGTGGGGGGGAGATGGAGGG - Intergenic
1067832145 10:49616423-49616445 GTCTGTTGGCGGGAGGTGGAGGG + Intronic
1067852311 10:49761872-49761894 GGCTGTGCGGGGGATGGGGAGGG - Intronic
1067985254 10:51136575-51136597 GTGTGTGTGTGGGAGGGGGGCGG + Intronic
1067997420 10:51289699-51289721 GTGTGTGTCTGGGTGGTGGATGG + Intronic
1068631710 10:59304827-59304849 GAGGGGGCGGGGGAGGGGGAGGG + Intronic
1068633678 10:59324752-59324774 GTGTATGAGGGGGTGGTGGCAGG - Intronic
1069421097 10:68247281-68247303 GTGTGTTGCGGGGAGGGGGAAGG + Intergenic
1069465910 10:68638797-68638819 GTGTGTGTGTGTGTGGTGGAGGG + Intronic
1069771853 10:70905447-70905469 GGGAGTGGAGGGGAGGTGGAAGG - Intergenic
1069997141 10:72349323-72349345 GTGGGGGCTGGGGAGGAGGAGGG + Intronic
1070150252 10:73800875-73800897 GTGCGTGCGCGGGGGGCGGAGGG + Intronic
1070278844 10:75034041-75034063 GTGAGAGTGGGTGAGGTGGAGGG - Intergenic
1070524825 10:77286759-77286781 GTGTGTGCGGGGGGGGGGGGGGG + Intronic
1070805692 10:79269440-79269462 GTGTGTTGGGGGGAGGTGTTGGG - Intronic
1070984037 10:80672859-80672881 GTGAGTGAGGGGGATGTGGATGG + Intergenic
1071239313 10:83686752-83686774 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1071239315 10:83686756-83686778 GTGTGGGGGGGGGGGGTGGGTGG + Intergenic
1071374662 10:84990447-84990469 GTGTGTGTTGGGGGGGAGGAGGG + Intergenic
1071733964 10:88277317-88277339 GTGCCTGCCGGGGAGGTGGGGGG + Intronic
1071946653 10:90653485-90653507 GTGTGTGAGGGGAAGCTGCAAGG - Intergenic
1072207446 10:93216771-93216793 GTATGTGCAGGGGAAGTGCAGGG - Intergenic
1072221825 10:93333493-93333515 GTGGGTGCAGGGGTGGTGGCAGG + Intronic
1072396108 10:95043470-95043492 GTGTGTGCGGTGGTGGAGCAGGG + Intronic
1072397370 10:95058785-95058807 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
1072578541 10:96720777-96720799 GGGTGTGGGGAGGAGGCGGAGGG + Intergenic
1072793031 10:98332622-98332644 GTGTGGCCTGGGGATGTGGATGG + Intergenic
1072881843 10:99235913-99235935 GTGTGTGTTGGGGGGGTGGTGGG - Intergenic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073090006 10:100928032-100928054 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
1073093819 10:100968174-100968196 GTGTGTGGCGGGGAGAGGGAAGG - Intergenic
1073102650 10:101014870-101014892 GTGTGTGAGGGCGAGCTGGGGGG - Intronic
1073148433 10:101295513-101295535 ATGTGTGTGGGGCAGCTGGAGGG - Intergenic
1073177466 10:101565207-101565229 GAGTGTATGGGGGAGGTGGGAGG - Intergenic
1073440154 10:103547712-103547734 GTGCGTGGGGTGGAGGTGAAGGG + Intronic
1073959803 10:108912638-108912660 GTGTGTGTCGGGGGGGTGGGGGG + Intergenic
1074056258 10:109924778-109924800 TTGTGTGCGTGGGTGGTGGCAGG - Intergenic
1074234064 10:111567016-111567038 GTGTGTGGGGAGGTGGGGGAGGG + Intergenic
1074422203 10:113319168-113319190 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1074422205 10:113319172-113319194 GTGTGGGGGGGGGGGGTGGGTGG + Intergenic
1074695856 10:116049791-116049813 CGGTGAGCGGGGGAGATGGAGGG + Intergenic
1074719205 10:116250093-116250115 GTGTGTGCTAGGGAGGAGAAAGG + Intronic
1074767973 10:116714544-116714566 GTGTGTCTGGGGGAGGGGGCAGG - Intronic
1075108731 10:119560506-119560528 GAGGGGGAGGGGGAGGTGGAGGG + Intergenic
1075242029 10:120787904-120787926 GGGTGTGGGGGGGATGGGGAGGG - Intergenic
1075419749 10:122291880-122291902 GGGTGTGGGGAGGAGGTGGTGGG + Intronic
1075787375 10:125059130-125059152 GTGTGGGCGGTGGGGGTGGGAGG + Intronic
1075834243 10:125439983-125440005 GTGTGTGGGGGGGTGGGGGTTGG + Intergenic
1075835774 10:125451487-125451509 GTGTGTGTGGAGGAGGCGGTGGG - Intergenic
1076120587 10:127934009-127934031 GTGTGTGCGCGGGGGGTGGGGGG - Intronic
1076178236 10:128385278-128385300 CTGTGTGCTGAGGAGGTGAATGG - Intergenic
1076256591 10:129031437-129031459 GTGTGTGCGTGTGAGATGCAGGG + Intergenic
1076292535 10:129358152-129358174 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
1076398245 10:130157365-130157387 GGGTGTGCGGAGGAGAGGGAGGG + Intronic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1076676509 10:132149868-132149890 GTGGGGGTGGGGGAGGGGGAGGG - Intronic
1076729283 10:132430149-132430171 GTGTGTGAGGGAGAGCAGGAAGG + Intergenic
1076896685 10:133316674-133316696 GTGTGTGGGGGGGGGGGGGGGGG - Intronic
1076896687 10:133316676-133316698 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
1076907942 10:133372766-133372788 GTGGGTGCGGGTCAGGTGGGGGG + Intronic
1076984191 11:223597-223619 GGGTGTGGGGGCGAGGTGGAGGG - Intronic
1077280250 11:1741400-1741422 GTGGGGGCAGGGGAGATGGATGG + Intronic
1077280824 11:1744632-1744654 ATGTGGGTGGGGGGGGTGGATGG + Intronic
1077284995 11:1761702-1761724 GTGTGTGGGGCTGAGGTGGGTGG - Intronic
1077287285 11:1773157-1773179 GTGGGGGAGGGGGAGGGGGAGGG + Intergenic
1077291936 11:1800849-1800871 GTGGGTTGGGGGGAGGGGGAGGG - Intergenic
1077305576 11:1867338-1867360 GTGTGTGTGGGTGTGGTGGGTGG - Intronic
1077340405 11:2023923-2023945 GTGTGTGTGGTGGAGGAGGCTGG + Intergenic
1077583529 11:3433296-3433318 GTTTGAGCCCGGGAGGTGGAGGG + Intergenic
1078143142 11:8705999-8706021 GTTTGGGAGGGGGAGGTGGGAGG + Intronic
1078854736 11:15197802-15197824 GTGTGTGGGCTGGTGGTGGAAGG - Intronic
1078927399 11:15886953-15886975 GTGTTTGGGGGTGATGTGGATGG - Intergenic
1078955583 11:16190782-16190804 GTGTGTGCGTGGCAGTGGGAGGG + Intronic
1079016111 11:16870288-16870310 GTGTGTGTGGGGGTGGGGGTAGG - Intronic
1079204273 11:18400416-18400438 GTGTGTGTGGTGGTGGTGGTAGG - Intronic
1079221318 11:18563506-18563528 GCTTGAGCTGGGGAGGTGGAGGG + Intronic
1079536311 11:21519612-21519634 GTGAATGTGTGGGAGGTGGAAGG + Intronic
1079886248 11:25993125-25993147 GGGTGAGAGTGGGAGGTGGATGG - Intergenic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1080136871 11:28865318-28865340 GTGTGGTCGGGGGAGGGGGGCGG + Intergenic
1080317386 11:30965743-30965765 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1080451847 11:32384488-32384510 GTGTGTGGGTGGGTGGTGGTCGG - Intergenic
1080823078 11:35825539-35825561 GTGTGTGCAGTGGGGGTGAATGG - Intergenic
1080935261 11:36856835-36856857 GTGTGTGCGGGGGGGGGGGGTGG - Intergenic
1081017449 11:37900668-37900690 GTGGGGTCGGGGGAGGTGGGAGG - Intergenic
1081296183 11:41392536-41392558 GTTTGTTTGGGGGAGGTGGTGGG - Intronic
1081497700 11:43632005-43632027 GTGAGGGAGGGGGAGGAGGAGGG + Intronic
1081667121 11:44923170-44923192 GTGTATGGGGTGGAGCTGGAGGG + Intronic
1081961080 11:47138000-47138022 GTGTGTGTGGGGGTATTGGAGGG - Intronic
1081977496 11:47244954-47244976 GTGTGTGTGAGGGAGGGAGAGGG + Intronic
1081991781 11:47341966-47341988 GAGTGTGCAGGGCAGGTGGATGG - Intronic
1082016880 11:47495947-47495969 TTGCCTGCTGGGGAGGTGGAGGG - Intronic
1082059388 11:47847635-47847657 GTGTGTGTGGGGGTGGGGGGGGG + Intronic
1082071601 11:47943949-47943971 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1082198469 11:49332569-49332591 GTTTGGGAGGGTGAGGTGGATGG + Intergenic
1082315533 11:50713758-50713780 GTGGGTTCGGGGGAGGGGGGAGG + Intergenic
1082811756 11:57482803-57482825 GTGCGTGGCGGGGAGGAGGAGGG - Intergenic
1082943949 11:58738909-58738931 GTGTGTGGGGGGGGGGGGTAGGG - Intergenic
1083725799 11:64627367-64627389 GTGTCTGCAGGGGAGGAGAAAGG - Intronic
1084004581 11:66316273-66316295 GAATGTGTGGAGGAGGTGGATGG - Exonic
1084028470 11:66467098-66467120 GCGTGTCTGGGGGTGGTGGAGGG + Intronic
1084035124 11:66504959-66504981 GTGTGTGTCGGGGGGGTGGTGGG - Intronic
1084174978 11:67418350-67418372 GTGGGTGTGGAGGTGGTGGAAGG + Intronic
1084240449 11:67816107-67816129 GTTTGAGCCCGGGAGGTGGAGGG + Intergenic
1084480826 11:69419073-69419095 AAGTGTGCGGGGGCAGTGGAGGG + Intergenic
1084665378 11:70573536-70573558 GTGTGTGTGGGGGCGGGGGGGGG + Intronic
1084725349 11:70938229-70938251 GTATGTGTGGGTGTGGTGGAGGG + Intronic
1084777462 11:71387038-71387060 GTGTGGGCGGGGCAGGGGGGCGG - Intergenic
1084831985 11:71776737-71776759 GTTTGAGCCCGGGAGGTGGAGGG - Intergenic
1085048288 11:73365925-73365947 CTGTGTCTGGGGGAGGTGGTGGG - Exonic
1085052060 11:73385006-73385028 GTGTGGGTGGGGGAGGTTGGTGG + Intronic
1085089727 11:73700602-73700624 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
1085204000 11:74719365-74719387 GTGTGTACAGGGGAGGGGGATGG - Intronic
1085304379 11:75476875-75476897 GTGTGGGCCGGGGTGGGGGATGG - Intronic
1085329981 11:75640180-75640202 GTGTGTGGGGGGGTGGGGGTTGG - Intronic
1085404725 11:76255007-76255029 GTGTGTGCAGGGGTGGGGGTGGG + Intergenic
1085807791 11:79652122-79652144 GTGTGTGCAGTGGTGGTGGTAGG + Intergenic
1085946635 11:81280429-81280451 GTCTGTTGGGGGGCGGTGGAGGG - Intergenic
1086888088 11:92226088-92226110 GTGTGTGCAGGGCAAGTGTAGGG + Intergenic
1086980536 11:93192372-93192394 ATGAGTGCGGGGGAGGAGTAGGG + Intronic
1087745020 11:101933977-101933999 GGATGTGAGAGGGAGGTGGAAGG + Intronic
1088010802 11:104998702-104998724 ATGTGTGTGTGGGAGGGGGAAGG + Intronic
1089112884 11:116071155-116071177 GTTGGGGCGGGGGAGTTGGAGGG + Intergenic
1089390592 11:118099149-118099171 GTGAGTGCGGGGGTGGGGGTTGG - Intronic
1089777884 11:120851694-120851716 GTGGGGGCGGGGGAGGGGCAGGG - Intronic
1089919131 11:122191075-122191097 GGGTTTGCCGGGGAGGTGGGAGG - Intergenic
1090397464 11:126428531-126428553 GTGTGTGCGGGGGAGGGGAGGGG + Intronic
1090804576 11:130194886-130194908 GTGTGTGAGACAGAGGTGGATGG + Intronic
1090885829 11:130875693-130875715 GTGAGGTCGGGGGAGGGGGAAGG + Exonic
1090942612 11:131400968-131400990 GTGTGTGTGTGGCAGGTGGCAGG - Intronic
1202823390 11_KI270721v1_random:79112-79134 GTGTGTGTGGTGGAGGAGGCTGG + Intergenic
1091382469 12:70963-70985 GTGTTTGGGGGAGAGGTAGAAGG - Intronic
1091605954 12:1951564-1951586 GTGTGGGGGGTGGAGGTGGGTGG + Intronic
1092127393 12:6084521-6084543 GCGGGTGCAGGGGAGGAGGAGGG + Intronic
1092172398 12:6382282-6382304 GTGTGTGCGTTGGTGGGGGAGGG + Intronic
1092253963 12:6916269-6916291 GTGTGTGGGGTGGGGGTGGGGGG + Intronic
1092578539 12:9814856-9814878 GTGTGTGTGTGGGAGGGGGGAGG + Intergenic
1092677364 12:10936134-10936156 GTGTGTGGGGGCGGGGTGGTGGG - Intronic
1094041469 12:26124943-26124965 GTGTGTGCGAGCGCGGTGGAGGG - Exonic
1094092025 12:26661270-26661292 GTGTGTGGGGGGGGGGGGGTGGG + Intronic
1094121839 12:26983225-26983247 GGGAGTGGGGGGGAGGTGGTGGG + Intronic
1094467789 12:30771959-30771981 TTGTGTGTGGGGGGGGGGGAGGG - Intergenic
1095392054 12:41719289-41719311 GTGTGTGTGGCGGGGGAGGAGGG - Intergenic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1096197194 12:49656350-49656372 GTGTTTGCGGGGGAGAAGGCAGG - Intronic
1096481306 12:51942922-51942944 GTGTGTGAGAAGGGGGTGGATGG + Intergenic
1096522245 12:52191096-52191118 GTGAGTGCGGGGCTGCTGGAAGG - Intronic
1096567732 12:52495357-52495379 ATGTGTGTGGGGGAGGAGGGTGG + Intergenic
1096580240 12:52580419-52580441 GTGGCTGGAGGGGAGGTGGAGGG - Intergenic
1096596856 12:52701380-52701402 GTGTGTGAGCGGGCGGAGGAGGG - Intronic
1096648914 12:53052581-53052603 GTGAGAGGGGTGGAGGTGGAGGG - Intronic
1096792027 12:54051469-54051491 GTGAGTGAGGGGGCGGAGGAAGG - Intronic
1096793362 12:54058985-54059007 GTGTGTTGGGGGGAGTTGTAGGG + Intergenic
1096893344 12:54794438-54794460 GTGGGGTCGGGGGAGGGGGAAGG + Intergenic
1097039084 12:56143634-56143656 GTGTCTGCGTGGGTGGGGGATGG + Intronic
1097185687 12:57195153-57195175 GTGTGTGGGGTGGAGTTGGGTGG - Intronic
1097546041 12:61002701-61002723 GTGGGGTCGGGGGAGGGGGAGGG - Intergenic
1097555192 12:61127793-61127815 GTGTGTGTGTTGGGGGTGGAGGG + Intergenic
1098160893 12:67648112-67648134 GGGTGTGTGGTGGAGGTGGGAGG + Intergenic
1098372318 12:69773553-69773575 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1098922522 12:76315565-76315587 GTGTGTGGGGGGTTGGGGGAGGG - Intergenic
1099052176 12:77793463-77793485 GGGTGTGGGGGGCAAGTGGAGGG - Intergenic
1099198222 12:79645023-79645045 GTGTGTGTGGTGGGGGTGGAGGG - Intronic
1099542629 12:83932134-83932156 GTGTGTGTGGGGGGGGGGGGCGG + Intergenic
1099566485 12:84254368-84254390 GTGGGGTCGGGGGAGGGGGAAGG + Intergenic
1099733699 12:86539166-86539188 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1100021259 12:90072006-90072028 GTGTGTGTGTGGGAGAGGGAGGG + Intergenic
1100405354 12:94267986-94268008 TTGTGTGCTGGGGAGGTGGGAGG + Intronic
1101040519 12:100750939-100750961 GTGTGTGTGTGGTAGATGGAGGG + Intronic
1101315524 12:103625501-103625523 GTGGGTGGGGGGAAGGAGGAGGG - Intronic
1101876064 12:108597661-108597683 CTGTGTGAGGGTGATGTGGACGG - Intronic
1101879000 12:108613834-108613856 GTGAGTCCAGGGGTGGTGGAAGG + Intergenic
1102009195 12:109607601-109607623 GTGTGTGTGGCGGGGGTGGGGGG - Intergenic
1102466021 12:113131240-113131262 GCGTGTGTGGGGGGGGTGGGGGG + Intronic
1102482464 12:113233198-113233220 TTGTGTGCGGGAAAGGGGGACGG - Intronic
1102687621 12:114736610-114736632 GGGGGCGCGGGGGAGGAGGAGGG - Intergenic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1102867922 12:116388948-116388970 GTGTGTGGCGGGAGGGTGGAGGG - Intergenic
1103350337 12:120279022-120279044 GCGGGTGAGGGGGAGGGGGAGGG + Intergenic
1103424717 12:120823202-120823224 GTGTGTGTGGGGGTGGGGGGTGG + Intronic
1103868975 12:124077392-124077414 TTGTGTGTGGGGTAGGTTGACGG + Intronic
1103954451 12:124568418-124568440 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1104000175 12:124855217-124855239 GCCTGTGCTGGGGAGGGGGAAGG - Intronic
1104058297 12:125246906-125246928 GGGTTTGTGGGGGAGGTGGTGGG + Intronic
1104205290 12:126632710-126632732 GTGTGTGTGGTGGAGTTGGGGGG + Intergenic
1104360558 12:128129147-128129169 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1104606962 12:130196931-130196953 GTGAGAGTGGGGGAGATGGAGGG + Intergenic
1104765152 12:131325675-131325697 ATGTGTGAGGGGGAGCTGGCAGG - Intergenic
1104814211 12:131636726-131636748 GTGTGTGAGGAGGAGCTGGCAGG + Intergenic
1104878861 12:132055462-132055484 GTGTGTGTGTGTGAGGTGTAGGG + Intronic
1104878867 12:132055502-132055524 GTGTGTGTGTGTGAGGTGTAGGG + Intronic
1104921180 12:132291601-132291623 GTGGGTGCTGTGGAGGTGGGTGG - Intronic
1104943763 12:132406604-132406626 GTCTGTGCTGGGGATGTCGAGGG - Intergenic
1105532066 13:21229301-21229323 GTGAGTGTGGGGGGGGTGGGAGG - Intergenic
1105740966 13:23322762-23322784 GGGGGGGGGGGGGAGGTGGATGG - Intronic
1105980756 13:25513976-25513998 GTGGGAGAGGGGGAGGGGGAGGG + Intronic
1106002600 13:25738337-25738359 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1106049695 13:26178504-26178526 ATGTGGGCGGGGGTGGGGGAGGG + Intronic
1106227933 13:27799045-27799067 GTGTGTGTGGGGGGGGGGGGTGG - Intergenic
1106348870 13:28908283-28908305 GTGGGGTTGGGGGAGGTGGAAGG - Intronic
1106395089 13:29371973-29371995 GTGTGTGTGGGGGGGGGGGCGGG - Intronic
1106452429 13:29895062-29895084 GGGGGCGGGGGGGAGGTGGAGGG + Intergenic
1106463851 13:29995510-29995532 GTGTGTGAGGGGCAGGAGGTGGG + Intergenic
1106726316 13:32490061-32490083 ATGTGTGTAGGGGAGGGGGATGG - Intronic
1106813239 13:33380472-33380494 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1107013172 13:35687653-35687675 GTGGGTGCGGGGGAGGTGGGTGG - Intergenic
1107108688 13:36673744-36673766 GTGTGTCGGGGGGAGGAGGGGGG - Intergenic
1107376588 13:39810790-39810812 GTGTTGGGGGGGGAGGTGGGAGG - Intergenic
1108115257 13:47120502-47120524 GGGTGTGCGGGGAAGCTGCAAGG + Intergenic
1108965699 13:56297836-56297858 GTGTGTGTGTGTGTGGTGGAAGG - Intergenic
1109013346 13:56977023-56977045 GTGTGTGTGGGTGTGGTGGTAGG + Intergenic
1109111235 13:58320880-58320902 GTGTGTGGGCGGGAGTTGTAGGG - Intergenic
1109267694 13:60219942-60219964 GTGGGTGGGAGGGGGGTGGATGG + Intergenic
1109881803 13:68487733-68487755 GTGTGTGTGGGAGAGGGAGAAGG + Intergenic
1110474019 13:75892064-75892086 GTGATTGCCAGGGAGGTGGAGGG + Intergenic
1110814427 13:79845658-79845680 GTGGGTTCGGGGGAGGGGGGAGG + Intergenic
1110978479 13:81868357-81868379 TTGTGTGCTGGAGATGTGGATGG - Intergenic
1111542239 13:89684297-89684319 GTGTCTGTGGGGGAAGGGGAGGG + Intergenic
1111640083 13:90957603-90957625 GTGTGTGTGGGGGTGGGGGGGGG - Intergenic
1112185551 13:97124740-97124762 GTGTGTGTTGGGGCGGAGGACGG + Intergenic
1112298229 13:98207895-98207917 GTGTGTGTGGAGGTGGTGGTCGG - Intronic
1112362119 13:98727797-98727819 GTGAGTGAGGGGGAAGGGGATGG - Intronic
1112447373 13:99476574-99476596 GTGTGTGGGGGGGGGGTGGCGGG - Intergenic
1112503159 13:99957373-99957395 GTGTGTGTGGGGGGGGTGGTAGG + Intergenic
1112657788 13:101470676-101470698 GTGTGTGTGGGAGGGGTGGAGGG + Intronic
1112671226 13:101641704-101641726 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1112726498 13:102310691-102310713 GTGTGTGGGGGGGGGGGGGTGGG + Intronic
1113039186 13:106085701-106085723 GTGTGTGTGGGGGGTGGGGAGGG + Intergenic
1113389594 13:109882666-109882688 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1113389598 13:109882670-109882692 GTGTGGGGGGGGGGGGTGGGGGG + Intergenic
1113521710 13:110946379-110946401 ATGTGTCCGGGGCAGGAGGACGG + Intergenic
1113541992 13:111115865-111115887 TTGTGTGCGGGGCAGGGGGAGGG + Intronic
1113625749 13:111845246-111845268 GTCTGTGGGGCGGAGCTGGACGG + Intergenic
1113794734 13:113050654-113050676 GTGGGGGCCGGGGCGGTGGAGGG + Intronic
1113909920 13:113836842-113836864 GGGAGTGGGGGGGAGGAGGAGGG + Intronic
1113934096 13:113984335-113984357 GTGAGTGATGGGTAGGTGGACGG - Intronic
1113995149 14:16058204-16058226 GGGTGGGCGGGCGAGGAGGATGG - Intergenic
1114203235 14:20542578-20542600 GTGTGGGGTGAGGAGGTGGATGG + Intergenic
1114492643 14:23113048-23113070 GTGTGTGTGGTGGTGGTGGTGGG + Intergenic
1115011686 14:28555765-28555787 GTGGGCATGGGGGAGGTGGAAGG + Intergenic
1115061413 14:29195058-29195080 GGGTGGGCGGTGGTGGTGGATGG - Intergenic
1115212736 14:30984130-30984152 GTGTGTGGGGGGGGGTTGGGGGG - Intronic
1115545683 14:34462879-34462901 GTGTGTGCATGGGTGGGGGAAGG - Intergenic
1115811142 14:37108901-37108923 GAGTGTGGGGAGTAGGTGGATGG - Intronic
1116062530 14:39941937-39941959 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1117383759 14:55191436-55191458 GTGGGTGCTGGAGAGCTGGACGG - Intronic
1117627672 14:57656293-57656315 GTGTGTGTGGGGGGTGTGGGGGG - Intronic
1117913186 14:60653402-60653424 GTGTGGGCGGTGGAGGTGGTGGG - Intronic
1117963990 14:61188581-61188603 GTGTGTGTCGGGGGGGTGGGGGG + Intronic
1118011168 14:61612036-61612058 GTGTGTGTGGAGGGGGTGGGAGG - Intronic
1118142663 14:63101621-63101643 GTGTGTGGGGTGGGGGCGGAGGG + Intronic
1118181045 14:63493500-63493522 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1118244835 14:64099891-64099913 GTGGGTTAGGGGGAGGGGGAAGG - Intronic
1118317892 14:64736920-64736942 CAGTGAGCGGGGGAGGAGGAGGG + Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118384328 14:65243247-65243269 GTGTGTGAGAGTGAGGTGGGTGG + Intergenic
1118456433 14:65948982-65949004 GTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1118900499 14:69981529-69981551 GTGTGTGTGGGAGAGGGGGACGG + Intronic
1119178686 14:72588843-72588865 GAGTGTGCAGGAGAGATGGATGG + Intergenic
1119482120 14:74964468-74964490 CTGTGTGCAGGGGAGGGGAAGGG + Intergenic
1119554891 14:75545755-75545777 GTGTGTGGGTGGGAGGTGGCGGG - Intronic
1119644322 14:76337548-76337570 GTGTGTGGGCGGGGGCTGGATGG + Intronic
1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG + Intergenic
1119733501 14:76966105-76966127 GTGTGTGTTGGGGTGGAGGATGG + Intergenic
1119974586 14:79011367-79011389 GTGGGTTGGGGGGAGGTGGGGGG - Intronic
1121162339 14:91755431-91755453 GTGATTGCAGGGGAGATGGATGG - Intronic
1121407523 14:93728076-93728098 GGGAGTCCGGGGGAGGGGGATGG - Intronic
1121473735 14:94175118-94175140 GTGTCTCCGGGAGAGGTGGGGGG - Intronic
1121610027 14:95272262-95272284 GTGTGGGCTGAGGAGCTGGAAGG + Intronic
1121692709 14:95889431-95889453 GGGTGAGGGGTGGAGGTGGAAGG - Intergenic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122452565 14:101822075-101822097 GTGTGTGTGGGGGGGGGGCAGGG - Intronic
1122601786 14:102925253-102925275 GCGTGTGCGGGTGGGGAGGATGG + Intronic
1122657393 14:103271390-103271412 GTGTGTGGGGGGGGTGTGGGGGG - Intergenic
1122657395 14:103271392-103271414 GTGTGTGTGGGGGGGGTGTGGGG - Intergenic
1122770089 14:104093956-104093978 GTATGGGCGGGGCTGGTGGATGG + Intronic
1122879468 14:104683599-104683621 GTGTGTGGTGGGGAGGGGGGCGG - Intergenic
1123208750 14:106738662-106738684 GTGTGGGGGGGGTAGGTGGGGGG - Intergenic
1123208754 14:106738666-106738688 GTGTGTGTGGGGGGGGTAGGTGG - Intergenic
1123633734 15:22281190-22281212 GTGTGTGGGGGGGAGAGGGGTGG - Intergenic
1124047754 15:26165937-26165959 GTGGGGGCGGGGGTGGTGCAGGG + Intergenic
1124884232 15:33669836-33669858 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
1124907845 15:33888307-33888329 GTGTGTGTGTGGCAGGGGGAAGG + Intronic
1124998397 15:34746370-34746392 ATGTGAGTTGGGGAGGTGGAAGG - Intergenic
1125183983 15:36909842-36909864 GTGTGTGTGGGGGTGGGGGTGGG + Intronic
1125186225 15:36933594-36933616 GTGTGTGTGGTGGGGGTGGGCGG + Intronic
1125310409 15:38372978-38373000 GTGGGGGAGGGGGCGGTGGAGGG - Intergenic
1125314655 15:38418223-38418245 GTGTGTGTGTGGGTGGTGGGGGG + Intergenic
1125437626 15:39664585-39664607 GTGTGTGTTGGGGTGGTTGAAGG - Intronic
1125463161 15:39925281-39925303 GTGTGTGATGGGGAGCAGGAGGG - Intergenic
1126437068 15:48646574-48646596 CTGTGTGTGGGGGAGGGCGAGGG - Intergenic
1127033147 15:54886349-54886371 GTGAGGTCGGGGGAGGGGGAAGG + Intergenic
1127165938 15:56244566-56244588 GGGTGGGGTGGGGAGGTGGAGGG - Intronic
1127222263 15:56892088-56892110 GTGTGTGAGCTGGTGGTGGAGGG + Intronic
1127283012 15:57508186-57508208 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1127397226 15:58552526-58552548 GAGGGGGCGGGGGAGGGGGAAGG - Intronic
1127397229 15:58552532-58552554 GTGGGTGAGGGGGCGGGGGAGGG - Intronic
1127586920 15:60387318-60387340 GTGAGTGTGGGGGAAGTGGAAGG - Intronic
1127682230 15:61309060-61309082 GTGTGTGGGGTGGAGGGGGAGGG + Intergenic
1128212724 15:65913692-65913714 GTGTGTGGAGGGGAAGAGGAGGG + Intronic
1128248578 15:66149533-66149555 GTAACTGCTGGGGAGGTGGAGGG - Intronic
1128632439 15:69280390-69280412 GTGTGTGGGGGGGTGGTGATGGG - Intergenic
1128700569 15:69801249-69801271 GGGTGGGCGTGGGAGGTGGCTGG + Intergenic
1129002478 15:72346206-72346228 GTTTTCGGGGGGGAGGTGGAGGG - Intronic
1129107485 15:73319667-73319689 GTGTGCACGGGGGATGTGCAAGG - Intergenic
1129184555 15:73897956-73897978 GTGTGTGCTGGGGGGCAGGAAGG - Intergenic
1129193833 15:73952808-73952830 GGGTGTGAGTGGGAGATGGAGGG + Intergenic
1129235365 15:74220589-74220611 ATGTGTGCGAGGGAGGGGAAAGG + Intergenic
1129288770 15:74547160-74547182 GTGTCGGCGGGGGAGGGGGAAGG - Intronic
1130257374 15:82332049-82332071 GTGTGTGTGTTGGAGGTGGGGGG - Intergenic
1130295253 15:82643094-82643116 GAGTGTGCTGGGGAGGGGAAGGG - Intronic
1130371058 15:83285238-83285260 GTGTGTGCGTGTGCGGTGGGGGG - Intergenic
1130428553 15:83823208-83823230 GAGGGTGAGGGGGAGGGGGAGGG + Intronic
1130597571 15:85257940-85257962 GTGTGTGTGTTGGAGGTGGGGGG + Intergenic
1130881965 15:88062986-88063008 GTGTGTGTGGGTGAGGGGGATGG - Intronic
1131241203 15:90744940-90744962 GTGTGGGAGGGTGAGGTGGGAGG + Intronic
1131406141 15:92166542-92166564 GTGAGTGAGGGGAAGCTGGAGGG - Intronic
1131520464 15:93110352-93110374 GTGTGCGTGTGGGAGCTGGAGGG + Intergenic
1131686788 15:94776937-94776959 GTGTATGGGGGGGAGGGGGTGGG - Intergenic
1131708197 15:95021443-95021465 GTGTGTAGGAGGGAGGGGGAAGG - Intergenic
1132055499 15:98648313-98648335 GTGTGCGCGCGGGAGGCGGTGGG + Intergenic
1132166958 15:99602724-99602746 GTGTGTGGGGGGGTGGGGGTGGG + Intronic
1132514077 16:358194-358216 GTGTGAGGGGGAGAGGAGGAAGG - Intergenic
1132577760 16:671813-671835 GTGTGTGCCGGGGAGGGGGCGGG - Intronic
1132644294 16:991719-991741 GGGTCTGCGGGGGGGGTGGGGGG - Intergenic
1132691299 16:1183038-1183060 GTGGGGGCGGGGGTGGTGGGTGG - Intronic
1132829008 16:1918491-1918513 GAGTGGGCGGGGGAGGGGGAGGG - Intergenic
1133047442 16:3096682-3096704 GTGTGGGTGGCCGAGGTGGATGG + Intronic
1133303081 16:4795091-4795113 GTGGGTGGGAGGGAGGGGGAAGG - Intronic
1133351898 16:5106845-5106867 GTTTGAGCCCGGGAGGTGGAGGG + Intergenic
1133413670 16:5589211-5589233 GTTTGTGGGGCGGTGGTGGAGGG + Intergenic
1133869672 16:9675457-9675479 GTGTGAGGAGGGGAGGTGGTAGG + Intronic
1133993371 16:10728059-10728081 GTGTGGGCAGTGGAGGAGGAGGG + Intergenic
1134427441 16:14164447-14164469 GTGTGTGCGGGGGTGGGGGATGG + Intronic
1135572201 16:23557768-23557790 GTGAGTGCGGCGGGGGTGGCGGG + Intronic
1135964533 16:27024864-27024886 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1136383088 16:29905987-29906009 GGGTGGGCGGGGGCGGAGGATGG + Exonic
1136405680 16:30045293-30045315 GTGTGTGTGGGGTGGGTGTATGG + Intronic
1136577345 16:31132448-31132470 GTGTGTGCTGGCTATGTGGAGGG - Exonic
1136692787 16:32047788-32047810 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136702233 16:32154768-32154790 CTGAGGGCGGGGGAGGTGGGCGG - Intergenic
1136765434 16:32772717-32772739 CTGAGGGCGGGGGAGGTGGGCGG + Intergenic
1136765443 16:32772732-32772754 GTGGGCGGGGGGGAGGTGGGAGG + Intergenic
1136793283 16:32991013-32991035 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136802656 16:33097647-33097669 GTGGGCGGGGGGGAGGTGGGAGG - Intergenic
1136802665 16:33097662-33097684 CTGAGGGCGGGGGAGGTGGGCGG - Intergenic
1137289423 16:47041860-47041882 GAGTGTGTGGGCGGGGTGGAGGG - Intergenic
1138195848 16:55051611-55051633 GGGTGGGCTGGGGATGTGGATGG - Intergenic
1138277212 16:55743737-55743759 GTGGGTGTGGGGGAGGTGGTCGG + Intergenic
1138512327 16:57515832-57515854 GTGTGTCCGGGAGAGCAGGAAGG - Intronic
1138529340 16:57626714-57626736 GTGTGTGTGGTGGTGGTGGTGGG + Intronic
1138667709 16:58586286-58586308 GTGGGGGTGGGGGAGGGGGAGGG + Intronic
1138691748 16:58775280-58775302 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1139340401 16:66264558-66264580 GAGTGAGCGGGGAAGGTGGGGGG - Intergenic
1139445761 16:66997464-66997486 GTAGTTACGGGGGAGGTGGAAGG + Intronic
1139481939 16:67235680-67235702 GTGTGTGGTGTGGGGGTGGAGGG - Intronic
1139839655 16:69868179-69868201 GTGTGTTGGGGGGTGGTGGCTGG + Intronic
1139846191 16:69923304-69923326 GTGTGTGTTGGGGGGGTGGGGGG + Intronic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140393072 16:74605174-74605196 GGGGGTTGGGGGGAGGTGGAGGG - Intronic
1140838599 16:78818320-78818342 GTGTGTGCTGGAGAGGGTGATGG - Intronic
1140871474 16:79110589-79110611 GAGTGTGTGTTGGAGGTGGAGGG - Intronic
1141034320 16:80614620-80614642 GTGTGGGAGGCCGAGGTGGATGG + Intronic
1141266149 16:82499157-82499179 GGGGGTGGGGGGGAGGGGGAGGG - Intergenic
1141266156 16:82499168-82499190 GTGTGTGTCGGGGGGGTGGGGGG - Intergenic
1141528574 16:84629640-84629662 GTCTGCGGTGGGGAGGTGGAGGG - Intergenic
1141588159 16:85048971-85048993 GTGTGTGAGAGGGAGAGGGAGGG + Intronic
1141633628 16:85302449-85302471 GTGTGTGTGGGGGCGGGGGGGGG - Intergenic
1141647158 16:85373701-85373723 GTGTGTGGCGGGTGGGTGGAGGG + Intergenic
1141651712 16:85396439-85396461 TTGGGTGCTGGGGAGGTGGAAGG - Intergenic
1141882335 16:86868265-86868287 TTGTGTGAGGGTGAGGTGGGCGG + Intergenic
1141892435 16:86935360-86935382 GTGTGTGTGGTTGAGGTGGGTGG - Intergenic
1142064763 16:88055274-88055296 GTGTGTGCGGAGGGGGTGGGTGG - Intronic
1142454436 16:90210476-90210498 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1203067822 16_KI270728v1_random:1034939-1034961 CTGAGGGCGGGGGAGGTGGGCGG + Intergenic
1203095542 16_KI270728v1_random:1252704-1252726 GTGTGTGGGGGGGGGGTGGTTGG + Intergenic
1142639174 17:1275706-1275728 GTGTGTGTGGGGGGGGTGTGTGG + Intergenic
1143001538 17:3798133-3798155 GTGTGTGGGGGAGAGCTGGCTGG - Intronic
1143077574 17:4357501-4357523 GTGTGTGTGGGGGGGGGGGGTGG + Intronic
1143109420 17:4545005-4545027 TGGTGAGTGGGGGAGGTGGAGGG - Exonic
1143143141 17:4754469-4754491 GTGTGTGTGGGGTAGGGGCAGGG - Intergenic
1143149850 17:4801125-4801147 GTGTGTGCTGGGGGTGTAGATGG - Intergenic
1143240968 17:5443114-5443136 GTGTGGGCGGGGGGGGTGGGGGG - Exonic
1143434672 17:6914733-6914755 GTGTGTGGGGGGGGGGGGGGGGG - Intronic
1143532075 17:7511343-7511365 GTGTGGGAGTGGGAGGAGGAAGG - Intronic
1143590706 17:7884770-7884792 GTGGGTGGGGGGGTGGTGGGGGG + Intronic
1143746943 17:9002121-9002143 GTGTGTGTGGGGGCGGGGGGCGG - Intergenic
1143746956 17:9002155-9002177 GTGTGTGTGGGGGTGGGGGGCGG - Intergenic
1143761988 17:9111419-9111441 GTGTGTGTGGTGGTGGTGGTAGG + Intronic
1143841680 17:9737220-9737242 GTGTGTGTGTGGGGGGTGGGGGG + Intergenic
1143873933 17:9977732-9977754 GTTTGTGCGGGGGTGGGGAAGGG + Intronic
1144382988 17:14721191-14721213 GTGGGGTCGGGGGAGGGGGAGGG + Intergenic
1144675331 17:17158211-17158233 GTGGGGGAGGGGGAGGGGGACGG - Intronic
1144675756 17:17160537-17160559 GTGTGTAGGGAAGAGGTGGATGG + Intronic
1144968861 17:19094488-19094510 GTGTGTGGGGGGGAGGTTGGAGG + Intronic
1144979055 17:19157578-19157600 GTGTGTGGGGGGGAGGTTGGAGG - Intronic
1144989167 17:19220654-19220676 GTGTGTGGGGGGGAGGTTGGAGG + Intronic
1145279822 17:21458749-21458771 GTGTGTGGCGGGGAGCAGGAGGG + Intergenic
1145398090 17:22511864-22511886 GTGAGTGAGGGAGAGGAGGAAGG - Intergenic
1145711752 17:26984427-26984449 GTGTGTGCTGGGGAGCAGGGAGG + Intergenic
1145781210 17:27564743-27564765 CTGTGGGTGGGGGAGGTGGGGGG - Intronic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1145895953 17:28458155-28458177 GAGGGAGCGGGGGAGGGGGAGGG - Intronic
1146180872 17:30697562-30697584 GTGTGTTCTGGGGAGGAAGAGGG - Intergenic
1146375366 17:32290242-32290264 GTGTGTGCCGGGCAGGGGGCTGG + Intronic
1146849250 17:36207709-36207731 GTGTGTGCGGGTGGGGAGGGAGG + Intronic
1146925484 17:36742043-36742065 GTGTGTGAGAGGGAGGAAGAGGG + Intergenic
1147056243 17:37837539-37837561 GTGGGGGTGGGGGAGCTGGAGGG - Intergenic
1147314236 17:39611974-39611996 GTGTGTGGAGGGGAGGTGGGAGG + Intergenic
1147317104 17:39626330-39626352 GTGTGTGCGGGGGAGGGTGTGGG - Intergenic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147390321 17:40105257-40105279 GTGTGGTGGGGGGAGGGGGATGG + Intergenic
1147440537 17:40444444-40444466 GTGTGTGTTGGGGAGGATGAGGG + Intronic
1147609540 17:41793472-41793494 GTGTGTGCGCGTGAGAGGGATGG - Intergenic
1147743297 17:42680663-42680685 GTGTGGGCGGGGGAGTTGTGTGG - Intronic
1148330168 17:46809459-46809481 GTGTGTGTTGGGGAGGGGGATGG - Intronic
1148481627 17:47963353-47963375 GCGTGAGCCCGGGAGGTGGAGGG - Intergenic
1148485573 17:47988668-47988690 GTGTGTGTGGGGGGAGGGGAAGG - Intergenic
1148654844 17:49275550-49275572 GTGTGTGGTGGGGTGGGGGATGG + Intergenic
1148738057 17:49875841-49875863 GTGGGGGTGGGGCAGGTGGAAGG + Intergenic
1148788021 17:50155240-50155262 GTGTGTTGGGGGGCGGGGGAAGG + Intergenic
1148839186 17:50483824-50483846 ATGTGTGTGGGGGGGGTGGCAGG - Intronic
1148949483 17:51297952-51297974 GTGTGTGTGTTGGGGGTGGAGGG - Intergenic
1149992049 17:61388796-61388818 GGGTGTGTGTGGGAAGTGGAGGG - Intronic
1150250538 17:63702008-63702030 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1150486028 17:65544382-65544404 GTGTGTGTGGTGGTGGTGGTGGG - Intronic
1150934648 17:69622604-69622626 GTGTGTGGCAGGGTGGTGGAGGG + Intergenic
1151210264 17:72539150-72539172 GTGTGTGTGGGTGTGGTGGGGGG - Intergenic
1151376482 17:73692299-73692321 GTGTGTGGTGGGGATGGGGATGG - Intergenic
1151581110 17:74979561-74979583 GTGAGGGCGGGGGAGATGAAGGG - Intergenic
1152479097 17:80538054-80538076 GCGGGAGCGGGGGAGGGGGAGGG + Intergenic
1153293751 18:3526118-3526140 GTGTGTGTGGTGGAGTGGGAGGG + Intronic
1153522216 18:5963914-5963936 GTGGGTGCAGGGCAAGTGGATGG - Intronic
1154520903 18:15229251-15229273 GTGTGGTCGGGGGAGGGGGGAGG - Intergenic
1154966538 18:21363284-21363306 GTGTGTGGGGGGGGGGGGGCGGG - Intronic
1155315805 18:24568935-24568957 GTGGGAGCAGGGGAGTTGGAGGG - Intergenic
1155333143 18:24738137-24738159 GTGTGTGTGGGGGTGGGGGCTGG + Intergenic
1155622384 18:27794647-27794669 GTGTGTGTGTGGGAGTTGGAGGG - Intergenic
1155786101 18:29901327-29901349 GTGGGGTCGGGGGAGGTGGGAGG + Intergenic
1156015050 18:32537983-32538005 GTGTGTGGGGGTGAGGGGGTGGG - Intergenic
1156461108 18:37321758-37321780 GAGTGAGAGGGGGAGGGGGAGGG + Intronic
1156497290 18:37534279-37534301 CTGGGTGCTGGGGAGGGGGAAGG + Intronic
1156627826 18:38931042-38931064 GTGTGTGCAGGGGAAGTTGGGGG + Intergenic
1156913140 18:42435000-42435022 ATGAGTGCATGGGAGGTGGAAGG + Intergenic
1157162260 18:45324750-45324772 GTGTGTGCGGGGGTGGGGGGCGG - Intronic
1157184625 18:45528175-45528197 GTGTGTGCGGGGGGGGGGGGGGG + Intronic
1157352915 18:46906766-46906788 GTGTGTGTGGGGGGGGGGGGAGG + Intronic
1157515474 18:48308148-48308170 GTGTGTGGGTGTGTGGTGGATGG - Intronic
1157584119 18:48790525-48790547 GTGTGTCCGGGGGATGGGGAGGG - Intronic
1157687379 18:49653100-49653122 CTGGATGCAGGGGAGGTGGAAGG - Intergenic
1157868970 18:51211952-51211974 GTGTGTGTGTTGGAGGTGAAGGG + Intronic
1157918472 18:51692745-51692767 GTGTGTGGAGGGGAGGGGGGCGG + Intergenic
1158408234 18:57179400-57179422 GTGTGTAGGTGGGAGGTGGCAGG + Intergenic
1158619997 18:59024695-59024717 GTATGCGCTGGGGAGGAGGAAGG + Intergenic
1158662000 18:59396610-59396632 GTGTGTGTGGTGGTGGTGGTGGG + Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1158913636 18:62096673-62096695 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1159033565 18:63255824-63255846 GTGTGTGTGGCGGGGGGGGAGGG - Intronic
1159603019 18:70446480-70446502 GTGTGTGTGGCGGAGGGGGTGGG + Intergenic
1159789325 18:72758403-72758425 GTGTGTGTGGAGGAGGGGGGTGG + Intronic
1160035363 18:75296716-75296738 GTGTGTGCAGAGCAGGGGGACGG + Intergenic
1160506039 18:79427387-79427409 GTGGGTTGGGGGGAGCTGGATGG + Intronic
1160506052 18:79427424-79427446 GTGGGTGGGGGGGAGCTGGACGG + Intronic
1160506095 18:79427567-79427589 GTGGGTCGGGGGGAGCTGGATGG + Intronic
1160506147 18:79427744-79427766 GTGGGTGGGGGGGTGCTGGACGG + Intronic
1160926812 19:1550401-1550423 GTGGGTGGGTGGGTGGTGGATGG - Intergenic
1160963373 19:1734665-1734687 GTGGGGGCGGCGGTGGTGGAAGG + Intergenic
1160975402 19:1790242-1790264 GAGTGGGCGGTGGAGGGGGAGGG - Intronic
1161241482 19:3225769-3225791 GTGGAGGCGGGGGAGGGGGAGGG - Intronic
1161352774 19:3803226-3803248 GGGTGTGAGGTGGAGGAGGACGG + Intergenic
1161447478 19:4326769-4326791 GTGTGTGTGGGGGAGGGGGCGGG - Intronic
1161782024 19:6299200-6299222 GGGTGGGCGGGGGGGGTGGATGG + Intergenic
1162066580 19:8129407-8129429 GTGTGTCCGAGGCAGGAGGAGGG + Intronic
1162096893 19:8315600-8315622 GTGTGAGAGGGGGATGTGGCAGG - Intronic
1162237375 19:9319803-9319825 GTGTGGTGGGGGGAGGGGGAGGG + Intergenic
1162386151 19:10361719-10361741 GTGTCTGTGGAGGAGGTGGCCGG - Intronic
1162394010 19:10405517-10405539 GTGTGTGGGGGGGAGGTTTGCGG + Intronic
1162470676 19:10870884-10870906 GTCGGTGCGGGGGCGGTGGGGGG + Intergenic
1162938047 19:13991562-13991584 GTGTCTGCGTGGGAGGTCCAGGG - Intronic
1162966040 19:14156559-14156581 GTGTGTGTGGGGGGGGTGGGGGG + Intronic
1162977709 19:14217970-14217992 GTGTGTTCTGGGGAGGAAGAGGG + Intergenic
1163085943 19:14979782-14979804 CTGGGCGCGGGGGAGGCGGAGGG - Intronic
1163117496 19:15197443-15197465 GTGTGTGGGGGCGGGGGGGAGGG - Intronic
1163124456 19:15237244-15237266 GTGGGGGGGGGGGGGGTGGAGGG + Exonic
1163164920 19:15489546-15489568 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1163972639 19:20813666-20813688 GTGGGTTGGGGGGAGGGGGAAGG + Intronic
1164380318 19:27730991-27731013 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1164828896 19:31305179-31305201 GTGTGTGTGGAGGGGGTGGCAGG - Intronic
1164830078 19:31313603-31313625 GGGTGTCTGGGAGAGGTGGATGG - Intronic
1165319760 19:35077887-35077909 GAGGGTGCCAGGGAGGTGGAAGG - Intergenic
1165323869 19:35102793-35102815 GTGAGTGAGGGGCAGGTGGGAGG - Intergenic
1165417939 19:35706340-35706362 GTAGGTGCGGGGCAGGTGCATGG + Intronic
1165605906 19:37104129-37104151 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
1165717595 19:38056396-38056418 GTGTGAGTGGGTGAGGGGGATGG - Intronic
1165823783 19:38693929-38693951 GTGAGTGCGGGGAAGGGGGGTGG - Intronic
1165928078 19:39339696-39339718 GTGTGTGGGGGGGGGGGGCAGGG - Intronic
1166026685 19:40092086-40092108 GTGGGGTCGGGGGAGGGGGAAGG + Intergenic
1166046579 19:40233952-40233974 CTGTGGGCGGCAGAGGTGGATGG + Intronic
1166066845 19:40365114-40365136 GTGTGTTTGGGGGAGCTTGAGGG + Intronic
1166109315 19:40612974-40612996 GGGTGTCTGGGGGAGGTGGTGGG - Intronic
1166133993 19:40764229-40764251 GTTTGTGGTGGGGAGTTGGAGGG + Intronic
1166204311 19:41259263-41259285 GTCTGTTCTGGGGAGCTGGAAGG + Intronic
1166403893 19:42505339-42505361 GTGTGTGGGGTGGAGGGGCAGGG + Intergenic
1167087641 19:47321052-47321074 GTGTGTGTGGGGGGGGTGGGGGG - Exonic
1167426337 19:49431596-49431618 GTGGGTGCGGGTGGCGTGGAGGG - Intronic
1167489210 19:49782128-49782150 GGGTCTGCGGGGGAGGGGGCTGG + Intronic
1167782189 19:51605977-51605999 GTGTGTGTGGGGGTGGAGGGAGG - Intergenic
1168195511 19:54771103-54771125 GTGTGTGGTGGGGAAGTGGTAGG + Intronic
1168264905 19:55217347-55217369 GTGACTGCGGGGGATGGGGAAGG + Intergenic
1168277135 19:55284483-55284505 GTGGGGGTGGGGGAGGTGGTAGG - Exonic
1168328080 19:55548398-55548420 GTGTATGGGGGGGTGGTGGGTGG + Intergenic
1202714778 1_KI270714v1_random:36186-36208 GTGTGTGAGAGGGAGGGAGAGGG - Intergenic
925200030 2:1959671-1959693 GTGTGTGAGGGGCAGAGGGATGG - Intronic
925405901 2:3605383-3605405 GTGGGTGCCGAGGAGGGGGAGGG + Intronic
925405932 2:3605471-3605493 GTGGGTGCTGAGGAGGGGGAGGG + Intronic
925584741 2:5453374-5453396 GTGTGGGAGGGAGAGGTGGATGG - Intergenic
925587044 2:5474854-5474876 GTGTGGGTGGGGCAGGTGGGTGG - Intergenic
926179528 2:10629080-10629102 GTATGTAGGGGAGAGGTGGAGGG - Intronic
926209134 2:10856132-10856154 GTGTGTTGGGGGGGGGTGGTGGG + Intergenic
927152577 2:20204309-20204331 GAGTGTGTTGGGGAGGTGGGGGG + Intronic
927203409 2:20592318-20592340 GGCGGGGCGGGGGAGGTGGATGG - Intronic
927463540 2:23320439-23320461 GTGTGTGGGGGGGCGGGGGATGG - Intergenic
927542537 2:23926412-23926434 GGGTCTGCGGGCGCGGTGGAGGG - Intronic
927596697 2:24403297-24403319 GCGTGTGGGGGGGTGGTGAAGGG - Intergenic
927702115 2:25275412-25275434 GTGTGTGAGGGGGCGGAGGGTGG - Intronic
927713755 2:25340757-25340779 GTGTGCGCGGGGGTGCTGGAGGG + Intronic
928023209 2:27720214-27720236 GTGTGTGCAGGGAAGGGGCAAGG + Intergenic
928225881 2:29447657-29447679 GTGGCTGGGGGAGAGGTGGAGGG + Intronic
928601414 2:32907508-32907530 GGCTCTGCGAGGGAGGTGGAAGG - Intergenic
928887546 2:36167368-36167390 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
928964883 2:36966542-36966564 GTGTGGGCGGGAGCGGCGGAGGG - Intergenic
929074545 2:38068909-38068931 GTGTGTGTGGGGTGGGGGGATGG - Exonic
929250527 2:39749755-39749777 GTCTGTCAGGGGGAGGTGGGAGG - Intronic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
929766575 2:44848640-44848662 GTGTGTGTGGGGGAGGGGTGGGG + Intergenic
929876326 2:45799993-45800015 GTGGGTCCTGGGGAGGAGGAAGG + Intronic
929920702 2:46169232-46169254 GTTTGTGCTGGGGAGGGGGATGG + Intronic
929932450 2:46269462-46269484 GTGTGTGAGGTGGGGGTGGGTGG - Intergenic
929937341 2:46303185-46303207 GTGTGTGTTGGGGAGGGGGGCGG - Intronic
930046121 2:47175154-47175176 GTGTATGCGGGGGAGGAGCAGGG - Intronic
930058460 2:47269903-47269925 GTGTGTGTGGTGGGGGTGGTGGG - Intergenic
930136270 2:47906229-47906251 GGGTGTGGGGGGGAGGAAGAGGG - Intergenic
930274599 2:49296865-49296887 GTGTGTGTGTGTGTGGTGGAGGG + Intergenic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
930401403 2:50894088-50894110 GTGGGTTGGGGGGAGGGGGAAGG + Intronic
930851512 2:55965940-55965962 GTGTGTGAAGGGAAGGAGGAAGG + Intergenic
931611441 2:64105786-64105808 GCGGGGGCAGGGGAGGTGGACGG - Intronic
931710672 2:64987646-64987668 GTGTGTGGGGGGGGGGGGGGTGG - Intergenic
932078450 2:68688969-68688991 GTGTGTGAGGCTGAGGTGGTGGG - Intronic
932102328 2:68912330-68912352 GTGGGTGTGGGGGAGGTAGGAGG - Intergenic
932140566 2:69273670-69273692 GTGTGGGTGGGGGAGGAGGTGGG - Intergenic
932424125 2:71618587-71618609 GTGTGTGTGGTAGAGGTGGTGGG + Intronic
932433053 2:71686831-71686853 GGGTGGGCGGGGAGGGTGGACGG + Intergenic
932780979 2:74558173-74558195 GTGTGTGCTGGGGGGTGGGAGGG - Exonic
933307810 2:80623743-80623765 TTGTGTGCTGGGGAGTGGGATGG - Intronic
933703515 2:85273149-85273171 GTGAGTGAGGAGGAGGTGGGAGG - Intronic
934068726 2:88364298-88364320 GTGTGTGGGGGCGAGGGGGGTGG - Intergenic
934601457 2:95661736-95661758 GTGTGTGTGAGAGGGGTGGAGGG + Intergenic
935197827 2:100830463-100830485 GTGGGGTCGGGGGAGGGGGAGGG - Intronic
935463036 2:103361849-103361871 GTGGCGGCGGGGGAGGGGGAGGG - Intergenic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
936011452 2:108927796-108927818 GTGCTTGGTGGGGAGGTGGAGGG - Intronic
936056215 2:109264154-109264176 GTGGATCCTGGGGAGGTGGATGG - Intronic
936056276 2:109264368-109264390 GTGGATCCTGGGGAGGTGGACGG - Intronic
936321101 2:111467755-111467777 GTGTGTGGGGGGGGGGGGGGTGG + Intergenic
936340059 2:111623226-111623248 GGGAGGGCGGGGCAGGTGGAAGG - Intergenic
936528751 2:113260373-113260395 GTGTGTGTTGGGGATGGGGATGG + Intronic
936534821 2:113303904-113303926 GTGTGTGTGAGAGGGGTGGAGGG + Intergenic
936538753 2:113333120-113333142 GAGTGTGCAATGGAGGTGGATGG + Intergenic
936644624 2:114354819-114354841 ATGTGTGTGGGGTTGGTGGATGG - Intergenic
936851945 2:116910122-116910144 GTGGGGTCGGGGGAGGGGGAAGG + Intergenic
936981471 2:118269161-118269183 GTGTCAGAAGGGGAGGTGGACGG + Intergenic
937120337 2:119436410-119436432 GTGTATCCTGGGGAGATGGAGGG + Intronic
937212319 2:120282551-120282573 GTGTGTGTTGGGGAGGGGGGCGG + Intronic
937246138 2:120495198-120495220 GTGTGTGTGTGGGGGGGGGAGGG - Intergenic
937248947 2:120511381-120511403 GTGTGTGTTGGGGGGGTGGGGGG - Intergenic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
937825584 2:126365382-126365404 GTGAGTGCGGGGGAAGGTGAGGG + Intergenic
937906741 2:127056198-127056220 GTGTGTGCAGGCGAGGGAGACGG - Intronic
937977361 2:127589806-127589828 ATGGGTGCTGGGTAGGTGGAAGG + Intronic
938102126 2:128504439-128504461 GTGTGTGGGGGGGGCGGGGAGGG + Intergenic
938403375 2:131012572-131012594 GTGTGTTGGGGGGTGGGGGAGGG + Intronic
939019280 2:136939862-136939884 GTGTGTCGGGGGGTGGTGGTAGG - Intronic
939046864 2:137259941-137259963 GTGTGTGTGGTGGAGGTTGTAGG + Intronic
939420212 2:141957378-141957400 GTGTGTGGGGGGGGGGGGGCGGG + Intronic
939630681 2:144523733-144523755 GTGTGTGTGGAGGAGGTGGGGGG + Intronic
939939320 2:148330037-148330059 GTGTGTGTGGGGGGGGCGGGGGG - Intronic
940039432 2:149344743-149344765 GTGGGTGCGGGAGTGGAGGAAGG + Intronic
940108959 2:150129297-150129319 GTGGATGCGGGAGAGGTGGCAGG + Intergenic
940214936 2:151295204-151295226 GTGTGTGTGGGGGGGGGGGGCGG - Intergenic
940457816 2:153923682-153923704 GTGGGGTCGGGGGAGGGGGAAGG - Intronic
940752772 2:157645928-157645950 GTGTGGTCGGGGGAGGGGGGAGG + Intergenic
940993382 2:160120516-160120538 GTGGGGTCGGGGGAGGGGGAAGG + Intronic
941029133 2:160492803-160492825 TCGCGTGCGCGGGAGGTGGAGGG + Intronic
941149237 2:161893252-161893274 GTGTGCGGAGGGGAGGTGGAAGG + Intronic
941200163 2:162498486-162498508 GTGTGTGGGGGGGAGGGTGGGGG + Intronic
941937585 2:170997368-170997390 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
942264723 2:174211164-174211186 GTGTGTTGTGGGGAGGAGGAAGG - Intronic
942307321 2:174621499-174621521 GTGTGGGCGATGGGGGTGGAGGG - Intronic
944238360 2:197461587-197461609 GTGTGTGTGAGGGAGGGAGAGGG + Intronic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
944734060 2:202545204-202545226 GTGTGGGGAGGGGAGGGGGACGG - Intronic
945267343 2:207903339-207903361 GTGTGCGGGGGTGAGGTGGTGGG + Intronic
945863716 2:215153324-215153346 GCGTGTGTGGGAGTGGTGGATGG - Intergenic
946058682 2:216922637-216922659 GTGAGGGTGAGGGAGGTGGAAGG + Intergenic
946115357 2:217457001-217457023 GTGTGTGGGGGTGAGGATGAGGG - Intronic
946139785 2:217680483-217680505 GTGTGTCAGGGGGAGGTGAGAGG + Intronic
946412724 2:219523018-219523040 GTGTGTGCGGGAGAGGGCGGGGG + Intronic
946433759 2:219639014-219639036 GTGTGTGTGGAGGAGCTGGCAGG + Intronic
946513983 2:220391775-220391797 GTGGGTGCAGGGGAGGAGGGAGG + Intergenic
946991199 2:225331596-225331618 GTGGGGTCGGGGGAGGTGGGAGG - Intergenic
947020280 2:225666850-225666872 GTGTGTGTTGGGGGGGTGGGGGG - Intergenic
947044876 2:225970460-225970482 GTGTGTGCGGCGGGGGTGGGGGG + Intergenic
947333451 2:229054712-229054734 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
947391215 2:229641506-229641528 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
947411718 2:229848320-229848342 GTGTGTGTGGGGGGGGCGGGGGG - Intronic
947626400 2:231621743-231621765 GTGGGTGCGGGGGATGAGGGGGG + Intergenic
948120716 2:235528349-235528371 GAGGGGGCGGGGGAGGGGGAGGG - Intronic
948229214 2:236337352-236337374 GTGTGGGCTGGGCAGGAGGAGGG - Intronic
948367246 2:237464946-237464968 GTGTGTGCGGGGGTGTGGGGGGG + Intergenic
948563635 2:238870113-238870135 GTGTGTGTGTGGGGGGTGTATGG - Intronic
948657689 2:239486900-239486922 GTGTGTGCGTGGGGTGTGGGAGG + Intergenic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
948948892 2:241236330-241236352 GTGGGTGCGGGGGCTGTGGAAGG - Intronic
949085894 2:242155131-242155153 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1168976389 20:1969268-1969290 GGGTGCTGGGGGGAGGTGGAGGG - Intergenic
1169194503 20:3675909-3675931 GTGTGTGTGGGGCAGGGGTAGGG - Intronic
1169267012 20:4172805-4172827 GTGGGAGGGGGGGTGGTGGAGGG + Intronic
1169867851 20:10219402-10219424 GTGGGTGCTGGGGAGGCGAAAGG + Intronic
1170243095 20:14191979-14192001 GTGGGGGAGGGGGAGGGGGAGGG + Intronic
1170428486 20:16258068-16258090 GTGTGTGTTTGGGAAGTGGAAGG - Intergenic
1170432070 20:16284914-16284936 GTGTGAGTGCGGGAGGTGGGAGG - Intronic
1170476976 20:16725118-16725140 GTGTGTGTTGGGCAGGAGGAGGG + Intergenic
1170525273 20:17229429-17229451 ATGGGTGCGGGGGAGTGGGAGGG + Intronic
1170549396 20:17463655-17463677 GTGTGTGGGGGGTGGGGGGATGG - Intronic
1170549397 20:17463659-17463681 GTGTGTGTGTGGGGGGTGGGGGG - Intronic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170811594 20:19678646-19678668 GTGTCCGGGAGGGAGGTGGAGGG - Intronic
1170989331 20:21287543-21287565 GTGTGGGCGGGGGGGGTGGGGGG + Intergenic
1171266175 20:23773748-23773770 AAGTGTGTGGGGGAGGTGCATGG - Intergenic
1171803180 20:29646796-29646818 GTGGGTTGGGGGGAGGGGGAAGG + Intergenic
1171865211 20:30484321-30484343 GTGTGGGTGGGCGAGGAGGACGG + Intergenic
1171953395 20:31440999-31441021 GTGTGTGAGGAGGAGTGGGAGGG + Intronic
1172013851 20:31861679-31861701 GGGTGGGCGGGTGAGGTGGGCGG + Intronic
1172033944 20:31999027-31999049 GTGTGTGGGGGGGTGGGGGGTGG - Exonic
1172283744 20:33726309-33726331 GTGTGTGTGGGGGTGGTGGTGGG + Intergenic
1172382380 20:34506144-34506166 GTTTGAGCCCGGGAGGTGGAGGG - Intronic
1172420976 20:34817248-34817270 GTGTGTGTGACGGAGGGGGAGGG + Intronic
1172934903 20:38613167-38613189 GTGTGTGTTGGGGACGTGGTGGG + Intronic
1172941657 20:38658574-38658596 GTGAGTGGGTGAGAGGTGGAAGG + Intergenic
1172944795 20:38678836-38678858 CTGGGTGCAGGGGAGGTGGTGGG - Intergenic
1172946106 20:38690682-38690704 GTGTGTTGGGGGGAGGGGGAAGG + Intergenic
1172964885 20:38827437-38827459 GTGTGTGTTGGGGAGGCTGAAGG - Intronic
1173036654 20:39418125-39418147 GTGTGTGGAGGGGGGGTGTATGG + Intergenic
1173057969 20:39634828-39634850 GTGTGTGTGGTGGGGGTGGCAGG + Intergenic
1173136988 20:40447381-40447403 GTGTGGGCAGGGGAGAGGGATGG - Intergenic
1173617322 20:44411528-44411550 GTGTGGGCGGGTGGGGTGGACGG + Intronic
1173653774 20:44684771-44684793 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1173881084 20:46412710-46412732 GTGTGTGGGGGGGGGGTTGTTGG + Intronic
1174080548 20:47968379-47968401 GTGTGTGGGGGGGGGGGGGGAGG - Intergenic
1174088797 20:48030223-48030245 GTGTAGGGTGGGGAGGTGGAGGG - Intergenic
1174127243 20:48315611-48315633 GTGTGGGGTGGGGAGGTGGAGGG + Intergenic
1174130241 20:48339473-48339495 GTGTGTGGCGGGGAGCTGGGGGG - Intergenic
1174419864 20:50392309-50392331 GTGTGTGGGGGTGAAGTCGATGG + Intergenic
1174814898 20:53678183-53678205 GTGTGTGCGGGGTGGGGGAAGGG + Intergenic
1174843220 20:53919216-53919238 GTGTGTGAGGGCGAAGGGGAGGG - Intergenic
1175238348 20:57527506-57527528 GGGAGGGCGGGGGACGTGGAGGG + Intergenic
1175278168 20:57786021-57786043 GTGTGTGGGGCGGCGGTGGTGGG + Intergenic
1175429692 20:58892210-58892232 GTGCGTGTTGGGGAGGGGGAGGG + Intronic
1175491571 20:59384007-59384029 GTGAGCGGGGAGGAGGTGGAGGG + Intergenic
1175553009 20:59829053-59829075 GTGTGTGCCTGGGTGGTGGCTGG + Intronic
1175597653 20:60248138-60248160 GTGTGTGTGTGGGAGGGGGGGGG - Intergenic
1175825925 20:61936481-61936503 CTGTGGGCAGGGGAGGCGGAGGG - Intronic
1175855132 20:62117008-62117030 GTGTGTGCGGCGGAAGGGGCAGG - Intergenic
1175869838 20:62203678-62203700 GGGTGCCCGGGGGAGGGGGAAGG - Intergenic
1176178908 20:63740563-63740585 GTGTGCGCAGGGGCGGTGGGTGG + Intronic
1176282737 20:64323872-64323894 GTGTTTGGGGGAGAGGTAGAAGG + Intergenic
1176372868 21:6073139-6073161 GTGTGTTGGGGGGGGGTGGGGGG - Intergenic
1176481639 21:7301388-7301410 GTGGGGTCGGGGGAGGTGGGAGG - Intergenic
1176946605 21:14989786-14989808 GTGTGTGGAGGTGAGGAGGAGGG + Intronic
1177194764 21:17892087-17892109 GGGTGTGATGGGGAGGTGAACGG + Intergenic
1177408599 21:20701612-20701634 GTGTGTTCGGGGGGGGTGGGGGG - Intergenic
1177543146 21:22521195-22521217 TTGTGTGCGGGGGTGGGGGCGGG + Intergenic
1177686533 21:24444172-24444194 GTGTGTGTGGCGGGGGAGGAGGG + Intergenic
1177758269 21:25373602-25373624 GTGGGAGAGGGGGAGGAGGAGGG - Intergenic
1178283885 21:31308688-31308710 GTGTGTGTGATGGAGGTGGGAGG + Intronic
1178494482 21:33075428-33075450 GTGTGTGGGGGGGTGGGGGTGGG + Intergenic
1178837861 21:36113662-36113684 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1178935238 21:36856059-36856081 GTGGGTGGGGGGCAGGGGGAAGG + Intronic
1179608077 21:42531172-42531194 GAGTGTGCGGGGAAGGCGGTGGG - Intronic
1179608088 21:42531215-42531237 GAGTGTGCGGGGAAGGCGGCGGG - Intronic
1179750609 21:43465104-43465126 GTGTGTTGGGGGGGGGTGGGGGG + Intergenic
1179800143 21:43807908-43807930 GTGTGTGTGGTGGTGGCGGAGGG + Intergenic
1180012213 21:45058617-45058639 GGGAGTGTGGGGGAAGTGGAGGG + Intergenic
1180311943 22:11249205-11249227 GGGTGGGCGGGCGAGGAGGATGG + Intergenic
1181056368 22:20262267-20262289 GTGTGTGCAGGAGAGATGCAGGG + Intronic
1181182519 22:21078025-21078047 GTGTGAGCTGGGGTGGTGGGAGG - Intergenic
1181645793 22:24231334-24231356 GGGGGTGCGGGGGAGGGGGTGGG + Intronic
1181748132 22:24970184-24970206 AAGTCAGCGGGGGAGGTGGAAGG - Intronic
1181997158 22:26892046-26892068 GTGTGTGTGGGGGTGGGGGTGGG + Intergenic
1182260719 22:29071697-29071719 GGGAGGGCGGGGGAGGAGGACGG + Intergenic
1182790298 22:32946541-32946563 GTGGGGCCGGGGGAGGGGGAGGG + Intronic
1183131480 22:35840652-35840674 GTGTGTAGGGGGGAGGAGGTAGG + Intronic
1183267498 22:36838190-36838212 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1183350621 22:37332850-37332872 GTGGTTGCGGGGGAGAGGGACGG - Intergenic
1183990523 22:41594391-41594413 GTGGGGGCGGGGGTGGTGGCGGG + Intergenic
1184098460 22:42329255-42329277 CTGTGTGCTGGGGATGAGGATGG - Intronic
1184104932 22:42362009-42362031 GGTGGTGCGGTGGAGGTGGAAGG + Intergenic
1184200128 22:42962768-42962790 GTGTGGGCGGGGGGGGGGGGCGG + Intronic
1184690895 22:46116778-46116800 GTGTTTGCGGGGGAGGTGTGGGG + Intergenic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1185288680 22:50013599-50013621 GTGTGTGTGTGGGGGGGGGATGG + Intergenic
1185288682 22:50013603-50013625 GTGTGTGGGGGGGGGATGGCGGG + Intergenic
1185297546 22:50061854-50061876 GTGTGTGCGGGGGGGGATGCAGG - Intronic
1185336808 22:50274654-50274676 GGGTGCTGGGGGGAGGTGGAGGG - Intergenic
1185336868 22:50274780-50274802 GGGTGCTGGGGGGAGGTGGAGGG - Intergenic
1185403174 22:50628854-50628876 GTGTGTGTGGTTGAGGTGTATGG + Intergenic
950096076 3:10331425-10331447 GTATGTGTGGGGCAGGGGGATGG + Intronic
950452755 3:13074352-13074374 GTGTGCGACAGGGAGGTGGAGGG + Intergenic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
950510199 3:13420989-13421011 GTGGGTGTGGGGGCCGTGGAGGG - Intergenic
950903586 3:16517633-16517655 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
951271524 3:20630358-20630380 GTGGGTTCGGGGGAGGGGGGAGG + Intergenic
952026190 3:29085805-29085827 GTTTGAGCCTGGGAGGTGGAAGG - Intergenic
952127699 3:30321163-30321185 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
952331999 3:32372130-32372152 GTGTGAGAGGGAGAGCTGGACGG - Intergenic
952386677 3:32846633-32846655 GTGGGTGCAGGGGAGGGGCAAGG - Intronic
952455343 3:33467035-33467057 GTGTGGGAGGGGGAGGGGGCTGG + Intergenic
952651248 3:35729352-35729374 GTGTGCTCTGGAGAGGTGGATGG - Exonic
952917913 3:38263462-38263484 GTGTGTGGGGTGGAGGGAGAGGG - Intergenic
953046874 3:39301357-39301379 GTGTGTTGGGGGGTGGAGGAAGG + Intergenic
953219262 3:40954010-40954032 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
953301344 3:41779834-41779856 GTGTGGTCGGGGGAGGGGGGAGG + Intronic
953407164 3:42665173-42665195 GGGTGAGCGTGGGGGGTGGAGGG + Exonic
953444661 3:42952822-42952844 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
953506478 3:43490789-43490811 GTGTGTGTGGGGGTGGTGCTGGG - Intronic
953825714 3:46249817-46249839 TTGTGTGCTGGGGATGTGGCTGG + Intronic
954004271 3:47579026-47579048 GGGAGTGCGGGGCAGGCGGACGG + Exonic
954376101 3:50195001-50195023 GTGTGGGGTGGGGAGCTGGACGG - Intronic
954436401 3:50498592-50498614 GTGTATACGTGGGAGGTAGATGG + Intronic
954505455 3:51067451-51067473 GTGTGTGCGCGCGCGTTGGAGGG + Intronic
954554902 3:51509989-51510011 GTGTGTGTGTGGGATGTGTATGG - Intergenic
954759806 3:52865890-52865912 GTGTGTGTAGGGGCGGTGGGGGG + Intronic
954945167 3:54417788-54417810 GTGTGTGTGGGGGGGGGGGTGGG + Intronic
955412869 3:58667215-58667237 GAGTGTGGGGGGGTGCTGGAGGG + Intergenic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955837729 3:63076008-63076030 GTGTGTGTGTAGGAGGTGGAGGG + Intergenic
955864384 3:63367440-63367462 GTTTGAGCCTGGGAGGTGGAGGG - Intronic
956284028 3:67589715-67589737 CTGTGTGCAGGAGAGGTGGATGG + Intronic
956312525 3:67897030-67897052 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
956322374 3:68011119-68011141 GTGTGTGTGTGGGGGGTGGTGGG + Intronic
956467656 3:69535513-69535535 GTGTGTGTGGTGGGGGTGGCGGG + Intronic
956825929 3:72996933-72996955 GTGTGTGCGAGGGAGGGGGAGGG + Exonic
956886900 3:73569549-73569571 GTGTGTGCGGGTGTGGGGGTGGG - Intronic
956907919 3:73786151-73786173 GTGTGTGCTGGGGATCTGTAGGG + Intergenic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
958473778 3:94554435-94554457 TTGTGTGGTGGGGTGGTGGAGGG + Intergenic
958875665 3:99613790-99613812 GTGTGTGGGGGGGGGGCGGGTGG - Intergenic
958883348 3:99697957-99697979 GTGGGTGAGGGGGTGGGGGAGGG - Intronic
958924565 3:100144137-100144159 CTCTGTGCGGGGGAGGAGTAGGG + Intronic
959396595 3:105847385-105847407 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
960072540 3:113447298-113447320 GTGTGTGTGTTGGAGGTGGGGGG - Intronic
960173108 3:114486130-114486152 GTGTGTGTGGGGGGGGGGGGCGG + Intronic
960692664 3:120363187-120363209 GTGTGTGGTGGGGAGGAGGGCGG + Intergenic
960846004 3:122005221-122005243 GTGAGTGCGGGGGAGGTGTCAGG - Intronic
961081854 3:124034052-124034074 GTCTGTGTTGGGGAGGTGGGAGG + Intergenic
961236876 3:125375046-125375068 GGGAGGGCGGGGGAGGGGGAGGG - Intronic
961484110 3:127205503-127205525 GTGAGTGGAGGTGAGGTGGAGGG - Intergenic
961503062 3:127350998-127351020 GTGTGTGCTGGGGAGGGAGTGGG - Intergenic
961564776 3:127755512-127755534 GCGTGTGGGTGGGAGGTGCACGG + Intronic
961667117 3:128499354-128499376 GTGTGTGCGGAGGAGATGGGGGG - Intergenic
962155549 3:132945258-132945280 GTGTGTGTTGGGGGGGTGGCGGG + Intergenic
962170242 3:133094227-133094249 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
962229555 3:133650359-133650381 GTGTGTGGGGGGCGGGGGGAGGG + Intronic
962910865 3:139848440-139848462 GAGTGGGCGGGGGAAGGGGATGG + Intergenic
963043248 3:141084308-141084330 AGGGGTGTGGGGGAGGTGGAGGG - Intronic
963447589 3:145434319-145434341 ATGTGTGTGGGGGTGGGGGAGGG + Intergenic
963603740 3:147397358-147397380 GTGTGTGAGGGGGTGGCGGTTGG - Intronic
964784438 3:160379551-160379573 GTGTGTGCTGGGGGCGAGGAGGG + Intronic
965519820 3:169661296-169661318 GTGTGGGGGGGGGAGTTGGCGGG - Intronic
966290781 3:178355561-178355583 GTGTGTGAGGTGGAGTTGAAGGG - Intergenic
966389151 3:179433345-179433367 GTCTGTGTGGTGGGGGTGGAGGG - Intronic
966417141 3:179701201-179701223 GTGTGTGCGGGGGTGGGGTGGGG + Intronic
966689843 3:182730999-182731021 GTGGGTTGGGGGGAGGGGGAAGG + Intergenic
966883451 3:184362177-184362199 GGGTGTGCGGGGGTGGAGGTTGG + Intronic
966886302 3:184379819-184379841 GGGGGAGCGGGGGAGGGGGAGGG - Intronic
967158539 3:186715238-186715260 GTGTGTGTGAGGGAGGAGTAGGG + Intergenic
967273071 3:187746596-187746618 GTGTGTGGGGGGGAGGGTGGGGG + Intergenic
967598043 3:191350990-191351012 GTGTATGTGGGGGATGTGGCAGG + Intronic
967962820 3:194939399-194939421 CTGGGTGCAGGGGAGGTAGAGGG + Intergenic
967988078 3:195110889-195110911 GTGTGTGTGGGTGAGGTGTGTGG + Intronic
968441147 4:625180-625202 GGGTGTGCTGGGGAGGTGGTGGG - Intergenic
968548704 4:1211579-1211601 GTCTGTCCTGGGGACGTGGAGGG - Exonic
968585533 4:1414490-1414512 GCGTGTCCGCGGGAGGTGGGTGG + Intergenic
968585574 4:1414612-1414634 GCGTGTCCGCGGGAGGTGGGTGG + Intergenic
968585596 4:1414673-1414695 GCGTGTCCGCGGGAGGTGGGTGG + Intergenic
968585608 4:1414704-1414726 GCGTGTCCGCGGGAGGTGGGTGG + Intergenic
968596894 4:1490338-1490360 GTGTGTGCCGGGGTGGGGGCCGG - Intergenic
968913885 4:3488832-3488854 GTGGGTGCTGTGGATGTGGAAGG + Intronic
968930254 4:3575207-3575229 GTGGGTGTTGGGCAGGTGGAGGG + Intergenic
968931226 4:3580529-3580551 GTGGGTGGGGGGGTGATGGATGG - Intronic
968985388 4:3871896-3871918 GCGGGGGCGGGGGAGGTGCACGG + Intergenic
968998710 4:3963086-3963108 GTTTGAGCCTGGGAGGTGGATGG + Intergenic
969330280 4:6470809-6470831 GTGTGTGCGAGAGAGGGGCAGGG - Intronic
969539905 4:7781787-7781809 GTGTGTGGGAGGGGGGTGGTGGG - Intronic
969564628 4:7970678-7970700 GACTGTGGGGGGGCGGTGGAGGG + Intronic
969815181 4:9681750-9681772 GTTTGAGCCTGGGAGGTGGAGGG - Intergenic
970341542 4:15112674-15112696 GTGGGGTCGGGGGAGGGGGAAGG - Intergenic
970416254 4:15860222-15860244 GTGTGTGTGTGTGTGGTGGAGGG + Intergenic
971043431 4:22779211-22779233 GTGGGTGGGGGGGGGGTAGAGGG - Intergenic
971109288 4:23565111-23565133 GGGAGTGAGGGGGAGGTGAAGGG - Intergenic
971111681 4:23592373-23592395 GGGTGGGGGGGGGAGGGGGAGGG - Intergenic
971114655 4:23630749-23630771 GTGTGTGTGGTGGTGGTGGACGG - Intergenic
971215945 4:24662264-24662286 GTGTGTGTGGGGGCGGGGGGGGG - Intergenic
971412650 4:26391450-26391472 GTGTGTGGGGGGTGGGTTGAAGG - Intronic
971529084 4:27661909-27661931 GTGGGTGGGTGGGAGGGGGATGG - Intergenic
971598149 4:28558241-28558263 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
971713002 4:30141323-30141345 GTGTGTGTGGGGCAGGGGGCAGG + Intergenic
972079955 4:35138221-35138243 GTGTGTGGGAGGGAGGTGGCTGG + Intergenic
972194800 4:36640742-36640764 GTGTGTGCTGGGGATATGGTGGG + Intergenic
972304142 4:37815757-37815779 GTGTGTGTGGGGGCGGGGGGGGG - Intergenic
972675146 4:41253032-41253054 GTGTGTTTGGGGGATGGGGAGGG - Intergenic
973110351 4:46390199-46390221 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
973570481 4:52233943-52233965 GTGTGGGGGGGGGAGGGGGGTGG + Intergenic
973797245 4:54440076-54440098 GTGTGGGGGGGGGGGGGGGAGGG + Intergenic
974195983 4:58576428-58576450 GTGGGTTCGGGGGAGGGGGGAGG - Intergenic
974671014 4:65030085-65030107 GTGGGGTCGGGGGAGGGGGAAGG + Intergenic
975199770 4:71573518-71573540 GTGGGGTCGGGGGAGGGGGAGGG - Intergenic
975241979 4:72070553-72070575 GTGTGTGTGGGGGGGGGGGGTGG + Intronic
975263762 4:72336842-72336864 GTGGGTGGGGCGGGGGTGGAGGG - Intronic
975330383 4:73106101-73106123 GTGTGTGTGGGGGAGGTTAGAGG + Intronic
975668311 4:76755121-76755143 CAGTGTGGGGAGGAGGTGGAGGG - Exonic
975973671 4:80072384-80072406 GAGTGTGCGAGGGAGGTCCAGGG - Intronic
976269071 4:83212435-83212457 GTGTGGGTGGGGGTGGTGGAGGG + Intergenic
976409562 4:84698027-84698049 GTGTGTGTGGTTGAGGAGGAAGG - Intronic
976484075 4:85580126-85580148 GTGTGTGTGGTGGGGGGGGAGGG + Intronic
976492110 4:85683104-85683126 GTGTGTGGGGGGGTGGGGGGGGG + Intronic
976497753 4:85750026-85750048 GTACGTGAGGGGCAGGTGGATGG - Intronic
976853647 4:89577772-89577794 GTGGGGTCGGGGGAGGGGGAAGG - Intergenic
977151203 4:93514406-93514428 GTGTGTACTGTGGAGGTGGGGGG - Intronic
977225355 4:94386999-94387021 TTGTGTGCTGGAGATGTGGATGG + Intergenic
977435766 4:96992392-96992414 GTGTGTGGGTGGGTGGGGGAAGG - Intergenic
977442706 4:97089550-97089572 GTGTGCGTGGGGGGTGTGGAAGG - Intergenic
977542643 4:98336753-98336775 GTGTTTGCAGTGGAGGTGGCAGG - Intronic
977690659 4:99905971-99905993 GTGTGTGGGGGGGAGGGAGTCGG - Intronic
978245786 4:106571184-106571206 GTGGGGTCGGGGGAGGTGGGAGG - Intergenic
978560739 4:110031035-110031057 GTGTGTGTGTGGGAGGGGGCTGG + Intergenic
979237600 4:118420030-118420052 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
979784741 4:124701767-124701789 GTGTGGGAGGCTGAGGTGGAAGG - Intronic
980167143 4:129242587-129242609 GTGTTTGTGGGGGAGCTGGAAGG + Intergenic
981768783 4:148282653-148282675 GTGGGAGTGGGGGAGTTGGAGGG + Intronic
981782699 4:148444966-148444988 GTGTGTGAGGGGGCGGTCGCAGG + Intergenic
981874944 4:149530797-149530819 GTATGTGGGGGGGGGGTGGGGGG - Intergenic
981956327 4:150478321-150478343 GGTTGTGTGGAGGAGGTGGAGGG - Intronic
982000060 4:151014577-151014599 GTGATGACGGGGGAGGTGGAGGG - Exonic
982206993 4:153004295-153004317 GTGTGTGGGGAGGAGGAGGAAGG + Intergenic
982236972 4:153260687-153260709 GTGTGTGTGGGGGGGGGGGTGGG - Intronic
982551934 4:156813040-156813062 ATGTGTGTGCGGGATGTGGAAGG + Intronic
983622710 4:169776687-169776709 GTGTGTGTGGGCGGGGTGGGGGG - Intergenic
983828450 4:172295720-172295742 GTGTGTGTGGGAGGGGTAGAGGG - Intronic
984199383 4:176698584-176698606 GTGTGTGTGGGGGAGTTGGGGGG + Intronic
984261394 4:177446702-177446724 GTGTGTGTGTTGGAGGTGGGTGG + Intergenic
984884049 4:184434306-184434328 GTGTGGGCCGGGAAGATGGAGGG - Intronic
985079014 4:186245641-186245663 GTGTGTGCTGGAGATGTGGCTGG + Intronic
985161261 4:187047253-187047275 GTGTGTGCGGGGGTGGGTGGGGG + Intergenic
985484527 5:140922-140944 GGGTGTGCAGGGGAGGGGGTGGG - Intronic
985484537 5:140943-140965 GGGTGTGCAGGGGAGGTTGTGGG - Intronic
985484568 5:141029-141051 GGGTGTGCAGGGGAGGGGGTGGG - Intronic
985484614 5:141138-141160 GGGTGTGCAGGGGAGGGGGTGGG - Intronic
985484624 5:141159-141181 GGGTGTGCAGGGGAGGTTGTGGG - Intronic
985484643 5:141202-141224 GGGTGTGCAGGGGAGGGGGTGGG - Intronic
985511907 5:318096-318118 GGGTGCGGGGGGGAGGTGGAGGG - Intronic
985511999 5:318329-318351 GGGTGAGGGGGGGAGGTGGAGGG - Intronic
985519425 5:366064-366086 GTGTGTGTGGGGCAGGGGGTGGG - Intronic
985986540 5:3521206-3521228 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
986283092 5:6339366-6339388 GTGTGTGGGTGGGCAGTGGAGGG + Intergenic
986806350 5:11312014-11312036 GTGTGTGGGGTGAAGGTGTATGG - Intronic
986818846 5:11443396-11443418 GTGTGTGTGGGGGGGGTGTGTGG + Intronic
986835834 5:11636028-11636050 GTGTGTGTGGCGGGGGTGGGGGG - Intronic
986866904 5:11999953-11999975 GTGTGTGTGGTGGGGGTGGGGGG - Intergenic
987264952 5:16243675-16243697 GTGTGTGTGGGGGTGGGGGCAGG - Intergenic
987536529 5:19196396-19196418 GTGTGTGAGTGGGAGGAGGCGGG + Intergenic
988623049 5:32843001-32843023 GTGTGTGTTGGGGGGGTGCAGGG + Intergenic
988949229 5:36241297-36241319 GTGTGTGCGAGGGAGAGGCAGGG - Intronic
988997119 5:36725171-36725193 GTGTGTGGGAGGGAGTAGGAAGG + Intergenic
989690607 5:44138625-44138647 GTGTGTTGGGGGGAGGGGGAGGG + Intergenic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
989810276 5:45664307-45664329 GTGGGGTCGGGGGAGGGGGAGGG + Intronic
990390699 5:55317037-55317059 GTGTGTGTGTGGGAGGGGGGAGG - Intronic
990449939 5:55924634-55924656 GTGGGGGTGGGGGAGGGGGAAGG - Intergenic
990788336 5:59448655-59448677 TTTTTGGCGGGGGAGGTGGAAGG + Intronic
990951747 5:61305243-61305265 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
991038628 5:62153563-62153585 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
991224409 5:64252917-64252939 GTGTGTGCTGGGGCGGGGGGTGG - Intronic
991246914 5:64518348-64518370 GTGTGTGTGGTGGTGGTGGCGGG + Intronic
991292303 5:65044816-65044838 GTGGGTGCTGGGGTGGGGGATGG - Intergenic
991375274 5:65958656-65958678 GTGAGGGAGGGGGAGGGGGAGGG + Intronic
992026417 5:72674071-72674093 GTGGGTGCTGGGGAGAGGGAAGG - Intergenic
992147776 5:73869212-73869234 GTGTGTGGGGTGGAGGGGGGTGG + Intronic
992158967 5:73982090-73982112 GTGTCTTCGGGGGAGCTGGGAGG + Intergenic
992189304 5:74275457-74275479 GTGTGGGTGGGGGAGGGGGGTGG - Intergenic
992383128 5:76258101-76258123 GTGTGTGGGGGTGTGGTGTATGG + Intronic
992752699 5:79875597-79875619 GCCTGTGCGTGTGAGGTGGAAGG + Intergenic
992789516 5:80201092-80201114 TTTTGTGGGGGGGTGGTGGATGG - Intronic
993395198 5:87377746-87377768 GTGTGTGTGGGCCAGGGGGAGGG - Intronic
993663042 5:90662753-90662775 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
993807746 5:92433489-92433511 GTGTGTGTGGTGGTGGTGGGTGG - Intergenic
993828351 5:92721961-92721983 GTGTGTGTGTGGGGGGTGGGGGG - Intergenic
993855564 5:93070435-93070457 GTGTGTGCGGGGGCGGGGGGCGG + Intergenic
993901015 5:93584457-93584479 GGGGGTGCGGGCGAGGCGGAGGG + Exonic
994367080 5:98928653-98928675 GTCCGTGCGGGGGAGGGGGAAGG + Exonic
994531435 5:100977764-100977786 GTGGGGGAGGGGGAGGGGGAAGG - Intergenic
994639515 5:102389443-102389465 GTGTGTGTGGGGGTGGGGGGCGG - Intronic
994639922 5:102395182-102395204 GTGGGGTCGGGGGAGGTGGGAGG - Intronic
994682064 5:102900249-102900271 GTGTGTGGGGGGGGGGCGGGGGG + Intronic
994798343 5:104335932-104335954 ATGTGGGGGGTGGAGGTGGATGG + Intergenic
995039361 5:107570643-107570665 GTGTGTGTGGGGGTGGGGGCGGG + Intronic
995202462 5:109441757-109441779 GTGGGGTGGGGGGAGGTGGAGGG - Intergenic
995294419 5:110502672-110502694 GTGAGTGAGGGGAAAGTGGAAGG - Intronic
995518105 5:112974246-112974268 GTGTGTGAGGAGGCAGTGGAGGG + Intergenic
995810555 5:116102807-116102829 GGGTGTGGGGGGCTGGTGGAGGG - Intronic
995841329 5:116446278-116446300 GTGTGTGTGGGGGTGGGGGATGG + Exonic
996147912 5:119997846-119997868 TTGTGGGCGGGGGAGGGGGGAGG - Intergenic
996198887 5:120645376-120645398 GTGTGTGGGGGGGGGATGGGTGG - Intronic
996198889 5:120645380-120645402 GTGTGTGTGTGGGGGGGGGATGG - Intronic
996376685 5:122816812-122816834 GTATGTGGGGGGGAGGGGGGAGG + Intronic
996744712 5:126836889-126836911 GGGTGGGGGAGGGAGGTGGAGGG + Exonic
996772125 5:127097008-127097030 GTGTGTGGGGGGGGGGGGGGCGG + Intergenic
996994840 5:129683230-129683252 GTGTATGTGGGGGAGGGGGGTGG + Intronic
997257346 5:132439189-132439211 CTTTATGCTGGGGAGGTGGATGG + Intronic
997426815 5:133808862-133808884 TTGTGTGCGGGGGCGGTGGGGGG - Intergenic
997526607 5:134557522-134557544 GTGGGTTCGGGGGAGGGGGGAGG - Intronic
997600748 5:135136797-135136819 TTGTGGGCGGGGGAGGGGGGAGG - Intronic
997681804 5:135761755-135761777 GTGTGGGCAGTGGAGGAGGAGGG + Intergenic
997692604 5:135836964-135836986 GTGTGGGGGGGGGGGGTGGGGGG - Intronic
997692608 5:135836968-135836990 GTGTGTGTGGGGGGGGGGGGTGG - Intronic
997698642 5:135880932-135880954 GTGTGGGTGGGGGTGGGGGATGG - Intronic
997760812 5:136445961-136445983 GTGTGTTCGGGAGAGGAGGAAGG - Intergenic
998005100 5:138651525-138651547 GTGTGTGTGGGGGTGGGGGCAGG - Intronic
998385850 5:141756743-141756765 GTGTGTGAAGGAGAGGTGGAGGG - Intergenic
998757265 5:145394432-145394454 GTGGGGTCGGGGGAGGGGGAGGG + Intergenic
999102722 5:149039943-149039965 GTGTGTGGGAGGGAGGTGAAGGG + Intronic
999319682 5:150605731-150605753 GTGTGTGTGGTGGGGGTGGTTGG - Intronic
999409323 5:151336684-151336706 ATGTGTGGGGGGGTGGGGGACGG - Intronic
999483221 5:151967788-151967810 GTCTGTGCCGGGGGGGTAGAGGG - Intergenic
999532914 5:152482004-152482026 GTGTGTGTGGGGCAGGGGAAGGG - Intergenic
999652091 5:153777677-153777699 GTGTGTGAGGGGGATGAGGGTGG - Intronic
999726612 5:154443539-154443561 GTGTGTGTGGTGGTGGTGGTGGG - Intergenic
999778024 5:154826282-154826304 GTTTGTGAGGCCGAGGTGGATGG + Intronic
999849598 5:155523915-155523937 CTGTGTGCTTGGGAGGGGGATGG - Intergenic
1000326362 5:160175584-160175606 GTGTGGGCGGCGGAGGTGGGGGG - Intergenic
1000373695 5:160560312-160560334 GTGTGTGTGAGGGAAGGGGAGGG + Intergenic
1000525724 5:162355170-162355192 GTGTGTGGGGGGTAGGGGGTAGG + Intergenic
1000563981 5:162825051-162825073 GTGTGTGGGGCAGGGGTGGATGG + Intergenic
1000623940 5:163517643-163517665 GTGACTGCTGGGGAGGTTGAAGG - Exonic
1001051194 5:168415791-168415813 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
1001085227 5:168695675-168695697 GTGTTTGGGGGGTAGGTGGGTGG + Intronic
1001110690 5:168893712-168893734 GTGAGTGAGGGGGAGGTGGCAGG + Intronic
1001198193 5:169692518-169692540 GTGTGTGGGGGTGGGGTGGCGGG + Intronic
1001350977 5:170964539-170964561 GTGGGGTGGGGGGAGGTGGAAGG - Intronic
1001381794 5:171310501-171310523 GTGTGTTTGGGGGAGGCAGAGGG - Intronic
1001438687 5:171721071-171721093 GCGGCTGTGGGGGAGGTGGAGGG - Intergenic
1001675089 5:173505383-173505405 GTGTGTGTGGGAGGGGTGGGTGG + Intergenic
1001757964 5:174185501-174185523 GTGTATGTGGGGGTGGTGGGTGG + Intronic
1001823823 5:174730219-174730241 GTGTGTGGTGGGGCGGTGGGGGG - Exonic
1001961832 5:175884290-175884312 GTGTGTGTGCGGGGGGTGGGGGG - Intergenic
1002058881 5:176614465-176614487 GTGTGGGGGGGGGAGGGGGGAGG + Intergenic
1002095410 5:176828072-176828094 GTGGGTGTGGAGGAGGGGGAAGG - Intronic
1002095730 5:176829607-176829629 GTGGATGGGTGGGAGGTGGATGG + Intronic
1002135320 5:177104084-177104106 GTGTGTCCCCGGGAGGTGGTAGG - Intergenic
1002204543 5:177553901-177553923 GTGGGCCCGGGGGAGGTGGCGGG + Intronic
1002374755 5:178780764-178780786 GTTTGCACGTGGGAGGTGGAGGG - Intergenic
1002389157 5:178895975-178895997 GTGAGTGCGGGGCCGGTGGCGGG + Intronic
1002419729 5:179139326-179139348 GTGTGTGGGGGTGAGGTGGGAGG + Intronic
1002422034 5:179153911-179153933 TTGTGTGCGGGGGAGGAGAGAGG - Intronic
1002663147 5:180804313-180804335 ATGTGTGCGGGGGTGTTGGGGGG - Intronic
1002738031 5:181411995-181412017 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1202772758 5_GL000208v1_random:26871-26893 GTGTGGTGGGGGGAGGTGGGAGG + Intergenic
1002761995 6:209561-209583 GTGTGTGTGGCGGAGGAGGGCGG + Intergenic
1002862774 6:1094945-1094967 GTGTGTGCCGGGGGTGTGGAGGG - Intergenic
1002971784 6:2030261-2030283 GTATGTGTGGGGGTGGTGCATGG + Intronic
1002987582 6:2205769-2205791 GTGTGTGTGGGGGGGGAGGGGGG + Intronic
1003234344 6:4282358-4282380 GTGTGGGGGGAGGGGGTGGATGG + Intergenic
1003338108 6:5194065-5194087 GTGTGTGGGGGGGTGGGGGGTGG + Intronic
1003476025 6:6483838-6483860 GTGTGTGTGGGGGTGGGGGGAGG - Intergenic
1004009060 6:11663913-11663935 GTGTGTGTAGGGGAGGCGGGCGG + Intergenic
1004080389 6:12386756-12386778 GTGTGTGTGGGGGGGGTGGTGGG + Intergenic
1004179096 6:13365461-13365483 GTGTGTGAGGTGCAGGTGCACGG - Exonic
1004193637 6:13486244-13486266 GTGTGTGTGGGGGGGGGGGATGG - Intronic
1004461443 6:15840737-15840759 GGGTATGGGGTGGAGGTGGAGGG - Intergenic
1004501539 6:16214431-16214453 GTGTGTGAAGCCGAGGTGGATGG - Intergenic
1005054399 6:21716451-21716473 GTGTGTGTGGGGTAGGGTGAGGG + Intergenic
1005194251 6:23264664-23264686 GTGTGTGTGGTGGGGGTGGGTGG + Intergenic
1005217169 6:23543983-23544005 ATGAGTGAGGGGGATGTGGAAGG + Intergenic
1005227134 6:23655979-23656001 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
1005463298 6:26089101-26089123 GTGTGTGTGGGGGGGGGGGGCGG + Intronic
1005611016 6:27525238-27525260 GTGTGTGTGTTGGAGGTAGAGGG + Intergenic
1005643259 6:27816928-27816950 GGGCGTGGGGGGGAGGGGGAGGG - Intergenic
1005710697 6:28501532-28501554 GAGGGGGAGGGGGAGGTGGAGGG - Intergenic
1005986242 6:30877423-30877445 GTGTGTATGGGGGATGGGGATGG + Intronic
1006116207 6:31777327-31777349 GTGAGAGCTGGGGAGGAGGAAGG + Intergenic
1006181459 6:32155610-32155632 GTGTGTGTGGTGGGGGTGGGGGG + Intronic
1006350964 6:33521008-33521030 GTGTGGGCGGGGGGGGGGGGGGG - Intergenic
1006398307 6:33801399-33801421 GTGTGTGGCAGGGAGCTGGATGG - Intronic
1006604284 6:35244934-35244956 GTGAGTTGGGGAGAGGTGGAAGG - Intronic
1006617380 6:35339728-35339750 GAGGGAGCGGGGGAGGGGGAGGG - Intergenic
1006677856 6:35776930-35776952 GCACGGGCGGGGGAGGTGGAGGG - Intronic
1006908124 6:37546404-37546426 GTGGGTGCGGGGGAGGGGTCAGG - Intergenic
1006931547 6:37692029-37692051 GTGGGTACGTGGGAGCTGGAGGG + Intronic
1006971448 6:38049885-38049907 GGGTGTGAGGGGGAGGGGGTGGG - Intronic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984055 6:38166213-38166235 CTGTACGTGGGGGAGGTGGAGGG - Intergenic
1006984063 6:38166241-38166263 GTGCGCAGGGGGGAGGTGGAGGG - Intergenic
1006984094 6:38166337-38166359 GTGCGGAGGGGGGAGGTGGAGGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984143 6:38166490-38166512 CTGTACGTGGGGGAGGTGGAGGG - Intergenic
1006984186 6:38166643-38166665 GGGAGTGCGGGGGAGGTGGAGGG - Intergenic
1006984221 6:38166774-38166796 GGGTGAGCAGGGGCGGTGGAGGG - Intergenic
1007077408 6:39076672-39076694 GTGTGTGAGGGTGTGGTGGGTGG - Intronic
1007278513 6:40693084-40693106 GTGTGTGGGGGCGAGAGGGAGGG - Intergenic
1007389962 6:41545434-41545456 GTGTGGGGCGGGGAGGGGGACGG + Intergenic
1007390173 6:41546326-41546348 GAGGGGGCGGGGGAGGAGGAGGG - Intergenic
1007390580 6:41547618-41547640 ATTTGTGCGCCGGAGGTGGAGGG + Intronic
1007394539 6:41570063-41570085 GTGTGTCAGGGGGTGGTGGGGGG - Intronic
1007518724 6:42434661-42434683 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
1007701673 6:43769726-43769748 GTGTGTGCGTGTGGGGTTGAGGG + Intergenic
1007751301 6:44073524-44073546 GGGTGGGAGGGGGAGGAGGAGGG + Intergenic
1007751351 6:44073676-44073698 GCGGGAGCGGGGGAGGGGGAAGG - Intergenic
1008235142 6:49037317-49037339 GTGTGTGTGGGGGCGGGGGAAGG + Intergenic
1008368265 6:50707067-50707089 GTGGGTGGGGGCGAGGGGGAGGG + Intergenic
1008400565 6:51058004-51058026 GTGTGGTGGGGGGAGGGGGAAGG - Intergenic
1008869814 6:56260043-56260065 GTGTGTGGTGGGGAGGTAGTGGG - Intronic
1008936493 6:56997961-56997983 GTGTGTGTGGGGGTGGGGGGCGG + Intronic
1009188898 6:60605808-60605830 GTGGGGTCGGGGGAGGGGGAGGG + Intergenic
1009190989 6:60629935-60629957 GTGGGGTCGGGGGAGGTGGGAGG - Intergenic
1009711344 6:67325508-67325530 GTGTGTGGGGTGGGGGGGGATGG + Intergenic
1009900170 6:69800102-69800124 GTATTTGTGGGTGAGGTGGAGGG - Intergenic
1009951570 6:70402936-70402958 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1009999233 6:70931183-70931205 GTGGGTTGGGGGGAGGGGGAAGG + Intronic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1011657140 6:89562217-89562239 GTCTCTGCCGGGGAGGGGGAAGG - Intronic
1011674491 6:89718904-89718926 GTGTGTGCAGATGAGCTGGATGG - Exonic
1011713862 6:90084093-90084115 GTGTGTGGGAGGGAAGGGGAGGG + Intronic
1011775987 6:90731104-90731126 GTGTATGTGAGGGAGGGGGAGGG + Intergenic
1011891087 6:92160516-92160538 GTGTGTGGGGGGGGGGGGGTGGG + Intergenic
1012313704 6:97759252-97759274 GTGTGTGTGGTAGAGGTGGTGGG + Intergenic
1012790101 6:103682408-103682430 GTGTGTAGGGGGGTGGGGGAAGG - Intergenic
1012855765 6:104499387-104499409 GTGTGTGCTGGGGGTGTGGGGGG - Intergenic
1012950164 6:105509742-105509764 GTGTGGGGTGGGGAGGTGGAAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013608737 6:111774560-111774582 GTGTGTGGGGGGGATGGGGAGGG - Intronic
1013610355 6:111788869-111788891 GTGGGTGGGAGGGAGGTGGGAGG + Intronic
1013878212 6:114860610-114860632 GTGTGTGGTGGGGGTGTGGAGGG + Intergenic
1014370721 6:120604029-120604051 GTGTGTGGGGGGGTGGGGGTGGG + Intergenic
1014606352 6:123477908-123477930 GTGGGGTCGGGGGAGGGGGAAGG + Intronic
1015180091 6:130352062-130352084 GTGTGTTGGGGGGAGGGGGGAGG + Intronic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1015413894 6:132926736-132926758 GTGTGTGAGCGGGAGGGGTAGGG - Intergenic
1015752940 6:136579231-136579253 GTGTGTGTTGGGGTGGTGGGTGG - Intronic
1015988560 6:138911656-138911678 ATGTGTGAGGGAGAGGAGGATGG + Intronic
1015988569 6:138911699-138911721 ATGTGTGAGGGAGAGGAGGACGG + Intronic
1015988578 6:138911742-138911764 ATGTGTGAGGGAGAGGAGGATGG + Intronic
1015988588 6:138911785-138911807 ATGTGTGAGGGAGAGGAGGAGGG + Intronic
1015988602 6:138911874-138911896 ATGTGTGAGGGAGAGGAGGACGG + Intronic
1016209251 6:141507909-141507931 GTGTGTGTGTGTGAGGTGGGGGG + Intergenic
1016363727 6:143293921-143293943 GAGAGTGAGGTGGAGGTGGAGGG - Intronic
1016370685 6:143371297-143371319 GTGTGTTGGGGGGCGGGGGAGGG - Intergenic
1016403327 6:143704109-143704131 GTGTGTGTGTGTGTGGTGGAGGG + Intronic
1016703226 6:147077375-147077397 GTGTGTGCCGGGCATGTTGATGG - Intergenic
1016808313 6:148235208-148235230 ATGTGTATGGTGGAGGTGGATGG + Intergenic
1016814099 6:148287689-148287711 GTGTGTGGGGGGGTGGGGGGTGG + Intronic
1016862947 6:148739729-148739751 GTGTGGGAGGTGGAGGTGGGTGG - Intergenic
1016900449 6:149096058-149096080 GTGTGTGCAGGGGTAGTGGTGGG - Intergenic
1017048898 6:150372311-150372333 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
1017048926 6:150372437-150372459 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
1017068670 6:150552443-150552465 GTGTGTGGGGGGGTGGGGGGTGG + Intergenic
1017456604 6:154606608-154606630 GAGTCTGCGTGGGAGGTGGGCGG - Intergenic
1017515550 6:155152805-155152827 GTGTGTGTGGTGGTGGTGGGTGG + Intronic
1017597949 6:156049654-156049676 GTGTGTGCTGGGGAGGGCGGTGG + Intergenic
1017705979 6:157123232-157123254 GTGTGTGGGGGGGGGGCGGGGGG - Intronic
1017931792 6:158961827-158961849 GTGTGTGTTGTGGAGGTGGAGGG + Intergenic
1018270732 6:162074479-162074501 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1018863431 6:167729903-167729925 GTGTGAGGGCAGGAGGTGGATGG + Intergenic
1019036750 6:169067311-169067333 GTGTGTGGGGGGGGGGGGGGGGG - Intergenic
1019036752 6:169067313-169067335 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1019060854 6:169256372-169256394 ATGTGTGCGCGGGAGGATGAGGG + Intergenic
1019130913 6:169873843-169873865 GTGTGGGGGTGGGAGGTAGATGG - Intergenic
1019243132 6:170687554-170687576 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1019345392 7:527177-527199 GGGTGGGAGGGGGAGGAGGAAGG + Intergenic
1019487786 7:1297197-1297219 GTGTGGGAGGGGGTGGTGGCAGG + Intergenic
1019691897 7:2419867-2419889 GTGGGGGCAGGGGAGGGGGATGG - Intronic
1019714077 7:2530388-2530410 GGGGGTGGGGGGGCGGTGGATGG - Intergenic
1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG + Intergenic
1020579904 7:9983945-9983967 GTGTGTGGGGGGGGGGGGGGCGG + Intergenic
1020642729 7:10776720-10776742 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
1021303110 7:18996831-18996853 GTGTGTGGCTGGGAGGTGGGGGG - Intronic
1021568299 7:22036662-22036684 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
1021716435 7:23467333-23467355 GTGTGTGCTGGAGAGCAGGAGGG - Intronic
1021816988 7:24456746-24456768 GTATGTGGGGTGGGGGTGGAAGG - Intergenic
1022090194 7:27103038-27103060 GAGTGTGCGGGGGAGGCAGAGGG - Intergenic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022290755 7:29000360-29000382 GTGGGTGGGGTGGGGGTGGAGGG + Intronic
1023385706 7:39655404-39655426 GTGTATGGAGGGGAGATGGAGGG + Intronic
1023825100 7:44003725-44003747 GTGGCCGCGGGTGAGGTGGATGG - Intronic
1024244392 7:47458252-47458274 GTGTGTGTGTGGGAGTTGGGAGG - Intronic
1024967413 7:55036266-55036288 GTGTGTGGGGGGGGGGGGGTGGG + Intronic
1025008208 7:55371917-55371939 GTGTGTGTGTGTCAGGTGGAAGG + Intronic
1025218803 7:57086355-57086377 GTGTGTGGGGGGGCAGGGGATGG - Intergenic
1025629728 7:63259943-63259965 GTGTGTGTGGGGGCGGGGGATGG - Intergenic
1025652546 7:63484084-63484106 GTGTGTGGGGGGGCAGGGGATGG + Intergenic
1025960892 7:66220662-66220684 GAGTGTGTGGGGGTGGTGGGTGG + Intronic
1026088649 7:67282510-67282532 GTGGCCGCGGGTGAGGTGGATGG - Intergenic
1026236913 7:68535084-68535106 GTGGGTGGGGGGGTGGTGGGTGG + Intergenic
1026490237 7:70856782-70856804 GTTTGTGAGGCGGAGGTGGGAGG + Intergenic
1026725600 7:72867843-72867865 GTGGCCGCGGGTGAGGTGGATGG + Intergenic
1026837962 7:73650554-73650576 GGGTGGGCGGTGGTGGTGGAAGG + Intergenic
1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG + Intronic
1027033891 7:74911001-74911023 GTGGCTGCGGGTGAGGTGGATGG + Intergenic
1027118245 7:75497810-75497832 GTGGCCGCGGGTGAGGTGGATGG - Intergenic
1027137857 7:75637979-75638001 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
1027250161 7:76393791-76393813 GGGTCTGCGGGGGATGGGGAAGG - Intronic
1027273557 7:76537658-76537680 GTGGCCGCGGGTGAGGTGGATGG + Intergenic
1027323284 7:77028306-77028328 GTGGCTGCGGGTGAGGTGGATGG + Intergenic
1027327005 7:77056714-77056736 GTGGCTGCGGGTGAGGTGGATGG + Intergenic
1027699810 7:81455991-81456013 GTGTGTGTGGGGGAGGGGGTGGG + Intergenic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1028283257 7:88960406-88960428 GTATGTGCGGGAGTGGGGGATGG + Intronic
1028394135 7:90348633-90348655 GTGGGGGTGGAGGAGGTGGAAGG + Intronic
1028899242 7:96077267-96077289 GTGTGTGTGTGGGAGGGGGCAGG + Intronic
1029397056 7:100315657-100315679 GTGGCCGCGGGTGAGGTGGATGG - Intronic
1029513761 7:101013190-101013212 GTGACTGCTGGGGAGGGGGAGGG - Intronic
1029719250 7:102352230-102352252 GTGGCCGCGGGTGAGGTGGATGG + Intergenic
1029753365 7:102557036-102557058 GTGGCCGCGGGTGAGGTGGATGG - Intronic
1029771316 7:102656120-102656142 GTGGCCGCGGGTGAGGTGGATGG - Intronic
1029985663 7:104921019-104921041 GTGTGTGGTGGGGTGGGGGAGGG - Intergenic
1030110161 7:106020041-106020063 GTGTGTGTGGGGGGGGGGCAAGG + Intronic
1030123425 7:106133034-106133056 GTGTGTGTGGGGGGGGGGGTTGG + Intergenic
1030348272 7:108456533-108456555 GGGAGTGCGGGGGAGGGGGACGG - Intronic
1030369906 7:108687082-108687104 GTGTGTGGTGGGTAGGTGGGAGG + Intergenic
1030685697 7:112485021-112485043 GTGGGTGTGGTGGAGGGGGAGGG + Intronic
1030787260 7:113677497-113677519 GTGTGTGTGTGTGAGATGGATGG - Intergenic
1030927540 7:115477066-115477088 GTGTGGGGGGGTGGGGTGGAGGG + Intergenic
1031144046 7:117978215-117978237 GTGTGAGGGGGAGAGATGGAGGG - Intergenic
1031422468 7:121567510-121567532 TTGTGTGCTGGAGATGTGGATGG + Intergenic
1031440152 7:121784659-121784681 GTCTGTCTGGGGGAGGTGGGGGG + Intergenic
1031898274 7:127379846-127379868 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1031968322 7:128044627-128044649 GTGTGTGTGGCGGGGGTGGGGGG - Intronic
1032739149 7:134721583-134721605 GTGTGTTTAGGGGAGGTGGGGGG + Intergenic
1032845428 7:135747978-135748000 GTGGGTGCAGTGGAGGTTGAAGG + Intronic
1032902325 7:136323759-136323781 GTGTGTGGTGGGGTGGTGGGGGG + Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033087139 7:138353018-138353040 GTTTGTGTGGGTGAGGGGGAGGG - Intergenic
1033440448 7:141373643-141373665 ATGTGTGTTGGGGGGGTGGAGGG - Intronic
1033837993 7:145338714-145338736 GTGTGTGTAGGGGAGGTAGATGG + Intergenic
1034065874 7:148136070-148136092 GAGAGGGAGGGGGAGGTGGAAGG + Intronic
1034352638 7:150427413-150427435 GTGTGTGGGGGGGGCGTGGGGGG + Intergenic
1034384442 7:150727576-150727598 GTGTGTGTGTGGGAGGTTGTTGG - Intronic
1034416373 7:150966378-150966400 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1034524658 7:151649972-151649994 GTGTGTGTCGGGGAGGTGAGGGG - Intronic
1034748739 7:153548295-153548317 GTGTGTGTGCGGGAGGTGGGTGG + Intergenic
1034977906 7:155458643-155458665 GTGCGGGCGCGGGAGGAGGAAGG + Exonic
1035336759 7:158134289-158134311 GTGTGTGAGAGGGAGCGGGAGGG - Intronic
1035504990 8:120609-120631 GTGTGGGCTGGGGAGGAGGATGG + Intergenic
1036040695 8:5077090-5077112 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1036081120 8:5557085-5557107 GTGGGTGGGGGGAAGGGGGAGGG - Intergenic
1036184138 8:6609813-6609835 GTGTGTGGGGGGGGGGCGGGGGG - Intronic
1036370704 8:8160685-8160707 GTGGGGGCGGGGGAGGCGGGAGG + Intergenic
1036638205 8:10565609-10565631 GTGTGTCGGGGGCAGGTGGGAGG - Intergenic
1036880190 8:12504946-12504968 GTGGGGGCGGGGGAGGCGGGAGG - Intergenic
1037110545 8:15159746-15159768 GTGTGTGTGGCGGGGGTGGGGGG - Intronic
1037207029 8:16335777-16335799 GTGGGTTGGGGGGAGGTGGGAGG - Intronic
1037275863 8:17177778-17177800 GTGTGTGTGGGGGTGGGGGGCGG + Intronic
1037670722 8:21013134-21013156 GTGTGTGGGGGGGGGGGGGGGGG - Intergenic
1037670724 8:21013136-21013158 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1038452206 8:27646968-27646990 GTGTGTGCGGGGGGGGGGCGGGG - Intronic
1038807881 8:30812099-30812121 GGGCGTGAGGCGGAGGTGGAAGG + Intronic
1039165439 8:34674400-34674422 GTGTGTGGGGGCGAGGGGGAGGG + Intergenic
1039440283 8:37590485-37590507 GTGTGTGTGGGATAGGAGGAGGG - Intergenic
1039468569 8:37800015-37800037 GTGGGTGTGGGGGTGCTGGAGGG - Intronic
1039641379 8:39227219-39227241 GTGTGTTCAGGAGAGGAGGAAGG - Intronic
1040471090 8:47736772-47736794 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1041340071 8:56835619-56835641 GTTTGTGGGGGGAAGGAGGAAGG - Intergenic
1041607658 8:59802194-59802216 GTGTGTGTGAGGGAGGTGGAAGG - Intergenic
1041970785 8:63740044-63740066 GTGTGTGGGGGGGCGGGGAAGGG - Intergenic
1042132934 8:65606922-65606944 GTGTGTGGGCCAGAGGTGGAGGG - Intronic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1042369794 8:67978198-67978220 GTATGTGCGGGGGGAGAGGAGGG - Intronic
1042581550 8:70284687-70284709 GTGTGTGTGGGTGTGGTGTACGG + Intronic
1042641934 8:70945891-70945913 CTTTGTGCGGCCGAGGTGGACGG + Intergenic
1042688120 8:71463638-71463660 GTGTGTGTGTGGGAGGGGGGAGG - Intronic
1043054599 8:75421945-75421967 GTGTGTGCGCGTCAGGTGGAGGG + Intronic
1043128021 8:76425302-76425324 GTGGGGTCGGGGGAGGGGGAAGG - Intergenic
1043267545 8:78285614-78285636 TTGCTTGCGGGGGAGGTGGAGGG + Intergenic
1043375226 8:79641589-79641611 GTGTGTGAGAGGGAGGAGCAGGG - Intronic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043725080 8:83601315-83601337 GTGTGGTCGGGGGAGGGTGAAGG + Intergenic
1044071390 8:87764532-87764554 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
1044469714 8:92552517-92552539 GTGTGTGTGGGGGGGGTGTTGGG - Intergenic
1044727932 8:95208176-95208198 GTGTGTGTGGGGGAGGGGGGGGG + Intergenic
1044951209 8:97437257-97437279 GTGTGTGTGGGGGAGGGCAAGGG - Intergenic
1045052145 8:98336989-98337011 ATGTGTGTGGGGGAAGGGGAGGG + Intergenic
1045108339 8:98915771-98915793 GTGTGTGGAGGGGCGGAGGATGG - Intronic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1045319333 8:101069920-101069942 GTGTGCGAGGGGGTGGGGGAAGG + Intergenic
1045535925 8:103027835-103027857 GTGTGTGCAGGGAGGGTGGGAGG - Intronic
1046422130 8:114000428-114000450 GTGGGGTCGGGGGAGGTGGGAGG - Intergenic
1046434437 8:114168602-114168624 GTGGGGTCGGGGGAGGGGGAAGG + Intergenic
1047005918 8:120620649-120620671 GTGTGTGTGGGGGTGGGGGTGGG - Intronic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1047619591 8:126592511-126592533 GTGTGTGGGGTGGGGGTGGTGGG + Intergenic
1047641773 8:126828425-126828447 GTGTGTGTTGGGGGGGTGGCAGG - Intergenic
1047759053 8:127940590-127940612 TTGTGGGGGGGGGCGGTGGAGGG + Intergenic
1047885297 8:129243678-129243700 GTGTGTGTGGGGGCGGGGGCAGG + Intergenic
1048277473 8:133077777-133077799 GTGTGTGCGGCAGAGTTGCAGGG + Intronic
1048294366 8:133203359-133203381 GTGTGTGATGGGCGGGTGGAGGG + Intronic
1048662570 8:136622026-136622048 GTGTGGTAGGGAGAGGTGGAGGG - Intergenic
1048693560 8:136996321-136996343 GTGTGTGCGGAGGTGGGGGATGG - Intergenic
1048786034 8:138051343-138051365 GTGTGTGGCGGGGAGTTGGGGGG + Intergenic
1048832134 8:138487627-138487649 GTGTGTGTGGGGGTGGGGGCGGG + Intronic
1049375062 8:142285442-142285464 GGGTGGGTGGGGTAGGTGGATGG + Intronic
1049400900 8:142426755-142426777 GGGAGTGCTGGGGAGGTGGTTGG + Intergenic
1049456097 8:142690107-142690129 GTGTGTGGAGGGGAGGCGGGGGG + Intergenic
1049468724 8:142765470-142765492 GGGGGTGGGGAGGAGGTGGAGGG + Intronic
1049536099 8:143183216-143183238 GTGTCTGCGGAGGAGGGGGCTGG + Intergenic
1049641246 8:143716940-143716962 GTGTGTGGGGGGGTGTTCGAGGG + Intronic
1050305363 9:4300108-4300130 GTGTGAGCGCCGGAGGGGGAGGG + Intronic
1050387952 9:5110825-5110847 GTTTGTTCGGGGAAGGTGGGGGG + Intronic
1050654789 9:7815896-7815918 GTGTTTGCGGGGAGGGGGGAGGG - Intronic
1050659594 9:7868399-7868421 GTGGGGTCGGGGGAGGGGGAAGG + Intronic
1050818396 9:9845486-9845508 GTGTTTGAGGGTGAGGTGGGGGG + Intronic
1051828297 9:21246899-21246921 TTGTGGGCGGGGGAGGGGGGAGG - Intergenic
1052041050 9:23739542-23739564 GTGTGTGTGGGGGTGGGGGTAGG - Intronic
1052048365 9:23820984-23821006 TTGTGTGCGGAGGTGGTGTAGGG - Intronic
1052049735 9:23831318-23831340 GAGTGAGAGGGGGAGGAGGAGGG - Intergenic
1052078249 9:24171938-24171960 GTGTGTGTGTGGCAGGGGGAGGG + Intergenic
1052764928 9:32631383-32631405 GTCTGTGCGGCGTCGGTGGATGG + Exonic
1053056642 9:34996889-34996911 GTGTGTGCTGGGGAGATGGTGGG + Intronic
1053699543 9:40675859-40675881 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054131406 9:61370203-61370225 GTTTGAGAGGGCGAGGTGGATGG + Intergenic
1054148622 9:61582828-61582850 GTGTGTGTGGGGGGGGGGGTGGG - Intergenic
1054246889 9:62675590-62675612 GTGTGTGGGGGGGGGGGGGGTGG + Intergenic
1054310832 9:63475260-63475282 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054409621 9:64799411-64799433 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054973318 9:71114601-71114623 GGTTGTGCGGTGGAGGTGGTTGG + Intronic
1055202941 9:73689747-73689769 GTGTGTTTGGGGGAGGGGAAAGG + Intergenic
1055403596 9:75950139-75950161 GTGTGTGGGGGGGGCGGGGAGGG + Intronic
1055447118 9:76394432-76394454 GTGTGAGCGGGGTGGGGGGAGGG + Exonic
1055533346 9:77210338-77210360 GTGGGTGGGGGTGAGGTGGGAGG - Intronic
1055564707 9:77556725-77556747 GTGTGTCTGGGGGTGGTGGTAGG - Intronic
1055681561 9:78721042-78721064 GTGAGTGCTGAGGAGGAGGATGG + Intergenic
1055689651 9:78815939-78815961 GTGTGTGTGGGGGGGGGGGTGGG - Intergenic
1055763238 9:79632461-79632483 GTGTCTGCCGGGAAAGTGGAGGG - Intronic
1055953336 9:81751152-81751174 CTGTGGGAGGCGGAGGTGGACGG - Intergenic
1056541003 9:87571420-87571442 GTGTGTTGGGGGGTGGGGGATGG - Intronic
1056812021 9:89772308-89772330 GTGGGAGCGGGGAAGGTGGTGGG + Intergenic
1057036708 9:91816690-91816712 GTGTGTGTTGGGGGGGTGGGGGG - Intronic
1057172562 9:92971948-92971970 GTGTGGGGGAGGGGGGTGGATGG - Intronic
1057439306 9:95071279-95071301 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1057546503 9:96022902-96022924 GTGTCTGTGGGGGAGGGAGAGGG - Intergenic
1057662434 9:97014872-97014894 GTGTGTTTGGGGGTGGTGGGTGG - Intergenic
1057801769 9:98195401-98195423 GTGTGTGTGGTGGGGGTGGGGGG + Intergenic
1057835048 9:98437893-98437915 GTGGGTGGTGGGTAGGTGGATGG - Intronic
1057850405 9:98562589-98562611 GTGTGTGTGGGGGTGGTGCAGGG + Intronic
1058093555 9:100833033-100833055 GTGGGTGGGGGGAAGGAGGAGGG + Intergenic
1058099736 9:100905690-100905712 GTGTGTGGGGGGGGGGGGGCGGG + Intergenic
1058139511 9:101342527-101342549 GAGTGGGAGGGGGAGGGGGAAGG + Intergenic
1058142884 9:101376655-101376677 GTGCGTGAGTGGGAGGTGGCAGG - Intronic
1058214594 9:102218051-102218073 GTGGGTTGGGGGGAGGTGGGAGG - Intergenic
1058432082 9:104928372-104928394 GTGGGTGGGGTGGGGGTGGAGGG + Intergenic
1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG + Intergenic
1059621540 9:116011181-116011203 GTGTGTGTGGGGGTGGGGGTGGG + Intergenic
1059780216 9:117518286-117518308 GTGTGTGTGGGCGGGGTGGGGGG - Intergenic
1059801953 9:117759042-117759064 GTGGGTGGGGGGCAGGGGGAGGG - Intergenic
1059935172 9:119303265-119303287 GTGTGTGTGGTGGGGGTGGGGGG - Intronic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060952544 9:127612929-127612951 GGGGGTGCGGGGGAGGGTGACGG - Intronic
1061050311 9:128191359-128191381 GTGTCTGCGGAGGAGGCGGCTGG - Intronic
1061165517 9:128919942-128919964 GGGTGGGTGGGGGAGGGGGAGGG - Intergenic
1061192389 9:129089296-129089318 GGGTGTGGGGTGGAGGAGGAGGG + Exonic
1061293392 9:129665150-129665172 GTGTGTGTGGGGGACCTGGCAGG + Intergenic
1061372983 9:130208214-130208236 GTGTGTGAGGTGGGGGTGGGGGG + Intronic
1061518491 9:131103387-131103409 GTGTGTGCGGGGGAAGGGCAGGG - Intronic
1061648867 9:132029864-132029886 GTGTGTGTGGGGGCGGGGGAGGG + Intronic
1061942778 9:133892070-133892092 GGGTGTGGGGAGGAGGGGGAAGG + Intronic
1062006374 9:134240336-134240358 GTGTGGCCGGGGGAGGAGGCGGG + Intergenic
1062032749 9:134369363-134369385 GTGTGTGCGGGGGTTGTGTGTGG + Intronic
1062060778 9:134494118-134494140 GTTGGTGCTGGGGTGGTGGATGG + Intergenic
1062088841 9:134663413-134663435 GAGTCTGCTGGGGAGGTGCAAGG + Intronic
1062119493 9:134826665-134826687 GTGTGTGTATGGGTGGTGGATGG + Intronic
1062222446 9:135424557-135424579 ATGTGTGCAGGGGGGGCGGAGGG + Intergenic
1062326281 9:136014045-136014067 GGGGGAGGGGGGGAGGTGGAGGG + Intronic
1062331677 9:136047646-136047668 CTGAGTACGGGGGAGTTGGAGGG + Intronic
1062370460 9:136236172-136236194 GGGAGTGGGGAGGAGGTGGAGGG - Intronic
1062559141 9:137131698-137131720 GTGTGTGTGGGGGGGGGGGGCGG - Intergenic
1062629223 9:137456200-137456222 GTGTGTGTGGGGGGGGGGGCTGG + Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1062733374 9:138121286-138121308 CTGTGTGCGGGGGAGGGCGATGG - Intronic
1203603321 Un_KI270748v1:36778-36800 GTGTGGGCTGGGGAGGAGGATGG - Intergenic
1185881684 X:3746801-3746823 GTGGGGGCTGGGGAGGCGGAGGG + Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186181656 X:6979307-6979329 ATGTGTGTGGAGGAGGTGGTGGG - Intergenic
1186502192 X:10060416-10060438 GTGTGTGTTGGGGAGGGGGTGGG + Intronic
1188243352 X:27814193-27814215 GGGTGTGAGGGGCAGGGGGAGGG - Intronic
1188421946 X:30000770-30000792 GTGTGTGTGGTGGTGGTGGTGGG + Intergenic
1188736858 X:33727396-33727418 GTGTGTGGGGAGGTGGGGGAGGG - Intergenic
1188878977 X:35468670-35468692 GTGTGGGGAGGGGAGGAGGATGG + Intergenic
1189047094 X:37605020-37605042 GTGTGTGCTGGAGAAGGGGAGGG + Intronic
1189074926 X:37905433-37905455 GTGTGTGGGGGGGGCGTGGGGGG + Intronic
1189241707 X:39529667-39529689 GTGTGTGTGGTGGGGGTAGATGG - Intergenic
1189252335 X:39611038-39611060 GTGTGGGACGGGCAGGTGGAAGG + Intergenic
1189307299 X:39996510-39996532 GTTTGTGAGATGGAGGTGGATGG - Intergenic
1189320224 X:40083263-40083285 GTGTGGTCGAGGGAGGTGGCTGG + Intronic
1190052488 X:47161062-47161084 GTGTGTGAGGCTGAGGTGGGAGG - Intronic
1190332049 X:49242165-49242187 GTGTGGGCGGGGGCGGTGAGGGG + Intronic
1190404016 X:50068232-50068254 GTGTGTGTGGAGGTGGGGGAGGG - Intronic
1190439444 X:50462980-50463002 GTGCGTGTGGGGGGGGTGGTGGG - Intronic
1190455387 X:50622683-50622705 GTGTGTGTGGTGGTGGGGGAAGG + Intronic
1190561634 X:51691654-51691676 GTGTGTGTGGTGGGGGTGGGAGG + Intergenic
1190562657 X:51701661-51701683 GTGTGTGTGGTGGGGGTGGGAGG - Intergenic
1190777336 X:53563526-53563548 GCCTGTGTGGGGGAGGTGGTGGG - Intronic
1190803538 X:53813990-53814012 ATATGTGCGGGGGATGTGGCTGG + Intergenic
1191605975 X:63063163-63063185 GTGGGTTGGGGGGAGGTGGGAGG + Intergenic
1191727487 X:64296722-64296744 TTGGGGGCGGGGGAGGGGGAAGG - Intronic
1191772580 X:64777354-64777376 GTGAGTGTGGGGGATGTGGGTGG - Intergenic
1191902225 X:66053361-66053383 GTGTGGGGGGGGGCGGGGGAGGG - Intergenic
1191972387 X:66831633-66831655 GTGTATGTGGGGCGGGTGGAGGG - Intergenic
1192233460 X:69281434-69281456 GTGTGTGGTGGGAAGGTGAAAGG - Intergenic
1192472052 X:71407587-71407609 GTCTGTGCGGCGCCGGTGGATGG - Exonic
1192553342 X:72070738-72070760 GTGTGTGTGGTGGTGGTGGTGGG - Intergenic
1192605776 X:72515582-72515604 GTGTGTGGGGGGGGGGTGGGGGG + Intronic
1192842590 X:74872436-74872458 GTGTGTGGGTGGGGGGTGGTGGG + Intronic
1193442270 X:81557036-81557058 GTGTGTGTGTGGGAGGGGGAAGG - Intergenic
1193465910 X:81847020-81847042 GTGGGTTCGGGGGAGGGGGGAGG + Intergenic
1193525686 X:82585581-82585603 TTGTGTGTGGTGGAGGTGGGAGG + Intergenic
1193685098 X:84568156-84568178 GTGTGTGTGGGAGGGGTGGGGGG - Intergenic
1194094540 X:89620902-89620924 GTGGGGGCGGGGGAGGGGGAAGG + Intergenic
1194256021 X:91635062-91635084 GTGGGGTAGGGGGAGGTGGAAGG + Intergenic
1194688998 X:96958721-96958743 GGGTGTGTGTGGGAGGTGGGAGG - Intronic
1194912757 X:99667015-99667037 GTGTGGGCGGGGGGGGGGGTGGG + Intergenic
1195001737 X:100649362-100649384 GTGGGTGCGGGGGAGTCGGGGGG - Intronic
1195273732 X:103257816-103257838 GTGTGTGTGTTGGGGGTGGAGGG + Intergenic
1195405564 X:104509209-104509231 GTGTGTGTGTGGGAGGGGGTTGG + Intergenic
1195636121 X:107118194-107118216 GTGGGGGGAGGGGAGGTGGAAGG - Intronic
1195688490 X:107605390-107605412 CTGTGTGTTGGGGAGGTGGGAGG - Intergenic
1195718627 X:107843663-107843685 GTGTGTGTTGCGGGGGTGGAGGG + Intronic
1195992115 X:110693149-110693171 GTGTGTGTGGGGGTGGGGGCAGG + Intronic
1196050651 X:111300018-111300040 GTGTGTGTGGTGGTGGTGGGAGG - Exonic
1196339099 X:114575572-114575594 GTGTGTGGGGGGGAGTGGGGGGG - Intergenic
1196624518 X:117863182-117863204 ATGTGTGGGGGGGTGGTGGGAGG - Intergenic
1196703297 X:118694587-118694609 GGGGGTGCGGGGGTGGGGGAGGG + Intergenic
1196893611 X:120311932-120311954 GTGTGTGTGGGGCGGGGGGAGGG + Intergenic
1197254146 X:124244838-124244860 GTATGTGTGGGGGTGGTGGCAGG + Intronic
1198703364 X:139420479-139420501 GTGTGTGTGGGGGTGGGGGGTGG + Intergenic
1198847587 X:140929352-140929374 GTGTGTGGAGGGGAGGAGGTGGG + Intergenic
1199036641 X:143058400-143058422 GTGTGTGTGTGGGTGGTGGTGGG + Intergenic
1199096597 X:143749190-143749212 GTGTGTGTGGGGGAGGTTGAAGG - Intergenic
1199425276 X:147693562-147693584 GTGTGTGGGGGGGCGGGGGAAGG - Intergenic
1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG + Intergenic
1199731055 X:150632551-150632573 GTGTGTGCAGAGTAGGTGGAGGG + Intronic
1200045549 X:153398987-153399009 GTGTGTGGGGGTGAGGGGGCAGG + Intergenic
1200092433 X:153642266-153642288 GGGGGGGCGTGGGAGGTGGAGGG + Intergenic
1200147784 X:153935311-153935333 GTGGGGGCGGGGGAGGGGGCGGG + Exonic
1200447175 Y:3277081-3277103 GTGGGGGCGGGGGAGGGGGAAGG + Intergenic
1200682150 Y:6225422-6225444 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1200689979 Y:6297424-6297446 GTGGGGTAGGGGGAGGTGGAGGG + Intergenic
1200698083 Y:6378813-6378835 GTGGGGTGGGGGGAGGTGGAGGG - Intergenic
1200783307 Y:7236552-7236574 GTGGGGGCTAGGGAGGTGGAGGG - Intergenic
1201036029 Y:9785886-9785908 GTGGGGTGGGGGGAGGTGGAGGG + Intergenic
1201045294 Y:9877296-9877318 GTGGGGTAGGGGGAGGTGGAGGG - Intergenic
1201076905 Y:10195945-10195967 GGGTGAGGGGGGGAGATGGAGGG + Intergenic
1201338476 Y:12905294-12905316 GTTTGTGAGGGGGCGGGGGAGGG + Intronic
1201476173 Y:14383856-14383878 GGGTGTGAGGAGGAGATGGAGGG - Intergenic
1202385392 Y:24321833-24321855 GTGTGAGCTGGGGAGGAGGATGG - Intergenic
1202485394 Y:25348295-25348317 GTGTGAGCTGGGGAGGAGGATGG + Intergenic