ID: 912222214

View in Genome Browser
Species Human (GRCh38)
Location 1:107690835-107690857
Sequence ATTCACCCTCTGCCAAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912222202_912222214 25 Left 912222202 1:107690787-107690809 CCCTTTGCCTTTCTCCTTGCTAT 0: 1
1: 0
2: 6
3: 60
4: 675
Right 912222214 1:107690835-107690857 ATTCACCCTCTGCCAAGGAGAGG No data
912222207_912222214 2 Left 912222207 1:107690810-107690832 CCCTTCCTGTCCTCATGGCCACC 0: 1
1: 0
2: 3
3: 52
4: 509
Right 912222214 1:107690835-107690857 ATTCACCCTCTGCCAAGGAGAGG No data
912222204_912222214 18 Left 912222204 1:107690794-107690816 CCTTTCTCCTTGCTATCCCTTCC No data
Right 912222214 1:107690835-107690857 ATTCACCCTCTGCCAAGGAGAGG No data
912222201_912222214 26 Left 912222201 1:107690786-107690808 CCCCTTTGCCTTTCTCCTTGCTA 0: 1
1: 0
2: 4
3: 79
4: 818
Right 912222214 1:107690835-107690857 ATTCACCCTCTGCCAAGGAGAGG No data
912222210_912222214 -8 Left 912222210 1:107690820-107690842 CCTCATGGCCACCACATTCACCC 0: 1
1: 0
2: 2
3: 29
4: 297
Right 912222214 1:107690835-107690857 ATTCACCCTCTGCCAAGGAGAGG No data
912222205_912222214 11 Left 912222205 1:107690801-107690823 CCTTGCTATCCCTTCCTGTCCTC 0: 1
1: 0
2: 4
3: 61
4: 983
Right 912222214 1:107690835-107690857 ATTCACCCTCTGCCAAGGAGAGG No data
912222208_912222214 1 Left 912222208 1:107690811-107690833 CCTTCCTGTCCTCATGGCCACCA 0: 1
1: 0
2: 0
3: 62
4: 428
Right 912222214 1:107690835-107690857 ATTCACCCTCTGCCAAGGAGAGG No data
912222209_912222214 -3 Left 912222209 1:107690815-107690837 CCTGTCCTCATGGCCACCACATT 0: 1
1: 0
2: 2
3: 19
4: 230
Right 912222214 1:107690835-107690857 ATTCACCCTCTGCCAAGGAGAGG No data
912222203_912222214 24 Left 912222203 1:107690788-107690810 CCTTTGCCTTTCTCCTTGCTATC No data
Right 912222214 1:107690835-107690857 ATTCACCCTCTGCCAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912222214 Original CRISPR ATTCACCCTCTGCCAAGGAG AGG Intronic
No off target data available for this crispr