ID: 912227741 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:107754699-107754721 |
| Sequence | GAGAGTGAAGGGAAGGATGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2337 | |||
| Summary | {0: 1, 1: 3, 2: 21, 3: 253, 4: 2059} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 912227741_912227750 | 21 | Left | 912227741 | 1:107754699-107754721 | CCACCATCCTTCCCTTCACTCTC | 0: 1 1: 3 2: 21 3: 253 4: 2059 |
||
| Right | 912227750 | 1:107754743-107754765 | TTCAGCTTCTTGAATACACCTGG | 0: 1 1: 0 2: 0 3: 13 4: 183 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 912227741 | Original CRISPR | GAGAGTGAAGGGAAGGATGG TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||