ID: 912227741

View in Genome Browser
Species Human (GRCh38)
Location 1:107754699-107754721
Sequence GAGAGTGAAGGGAAGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2337
Summary {0: 1, 1: 3, 2: 21, 3: 253, 4: 2059}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912227741_912227750 21 Left 912227741 1:107754699-107754721 CCACCATCCTTCCCTTCACTCTC 0: 1
1: 3
2: 21
3: 253
4: 2059
Right 912227750 1:107754743-107754765 TTCAGCTTCTTGAATACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912227741 Original CRISPR GAGAGTGAAGGGAAGGATGG TGG (reversed) Intronic
Too many off-targets to display for this crispr