ID: 912227750

View in Genome Browser
Species Human (GRCh38)
Location 1:107754743-107754765
Sequence TTCAGCTTCTTGAATACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 183}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912227743_912227750 14 Left 912227743 1:107754706-107754728 CCTTCCCTTCACTCTCCATTTCC No data
Right 912227750 1:107754743-107754765 TTCAGCTTCTTGAATACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 183
912227747_912227750 -7 Left 912227747 1:107754727-107754749 CCAGCCACTCTTACCTTTCAGCT 0: 1
1: 0
2: 0
3: 27
4: 308
Right 912227750 1:107754743-107754765 TTCAGCTTCTTGAATACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 183
912227741_912227750 21 Left 912227741 1:107754699-107754721 CCACCATCCTTCCCTTCACTCTC 0: 1
1: 3
2: 21
3: 253
4: 2059
Right 912227750 1:107754743-107754765 TTCAGCTTCTTGAATACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 183
912227742_912227750 18 Left 912227742 1:107754702-107754724 CCATCCTTCCCTTCACTCTCCAT 0: 1
1: 1
2: 20
3: 255
4: 2771
Right 912227750 1:107754743-107754765 TTCAGCTTCTTGAATACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 183
912227740_912227750 22 Left 912227740 1:107754698-107754720 CCCACCATCCTTCCCTTCACTCT 0: 1
1: 0
2: 6
3: 110
4: 1548
Right 912227750 1:107754743-107754765 TTCAGCTTCTTGAATACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 183
912227746_912227750 -1 Left 912227746 1:107754721-107754743 CCATTTCCAGCCACTCTTACCTT 0: 1
1: 0
2: 2
3: 44
4: 447
Right 912227750 1:107754743-107754765 TTCAGCTTCTTGAATACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 183
912227744_912227750 10 Left 912227744 1:107754710-107754732 CCCTTCACTCTCCATTTCCAGCC No data
Right 912227750 1:107754743-107754765 TTCAGCTTCTTGAATACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 183
912227745_912227750 9 Left 912227745 1:107754711-107754733 CCTTCACTCTCCATTTCCAGCCA No data
Right 912227750 1:107754743-107754765 TTCAGCTTCTTGAATACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912227750 Original CRISPR TTCAGCTTCTTGAATACACC TGG Intronic
901249657 1:7766943-7766965 TTCAGCTTCTTGGAAATAACCGG - Exonic
901987573 1:13088272-13088294 TCCAGCTTCTTGAGCAAACCAGG - Intergenic
901994239 1:13138495-13138517 TCCAGCTTCTTGAGCAAACCAGG + Intergenic
904553215 1:31338843-31338865 TTGAGCTTCTTTAATGGACCAGG - Intronic
906247762 1:44289219-44289241 TTCAGCTTCATGAATGCAAGAGG + Intronic
909272904 1:73646740-73646762 TTCAGGTTCTTGATGACAACTGG + Intergenic
910220675 1:84886946-84886968 TTCAACTTATTGAATACATAAGG + Intronic
910268748 1:85369627-85369649 TTCAGCATTTTCAATATACCTGG + Intronic
911523714 1:98959658-98959680 ATAAGCTTCTTGAAGACAACTGG - Intronic
912227750 1:107754743-107754765 TTCAGCTTCTTGAATACACCTGG + Intronic
912346780 1:108970705-108970727 TTCAGTTTTTTGAATGCAACAGG - Exonic
912968114 1:114254731-114254753 TTCTACTTCTTGAATAGAACTGG + Intergenic
913278898 1:117166155-117166177 CTCAGCTCCTTGAATGCACAGGG - Intronic
915780199 1:158541498-158541520 TTGAGCTTCTTGCATATACTTGG + Intergenic
918888512 1:190231137-190231159 ATCAGCTTTTTGAAAACACATGG + Intronic
919652288 1:200162388-200162410 TTCAGTTTCTTGAATGTGCCTGG - Intronic
920095482 1:203483746-203483768 TCCAGCTTGCTGAAGACACCAGG - Exonic
920714868 1:208330489-208330511 TTCAACTTCCTGAACACAGCTGG + Intergenic
922041446 1:221902425-221902447 ATCTGCTTCTTAAATAGACCAGG - Intergenic
922918233 1:229276505-229276527 TTCAGCTACCTAACTACACCTGG + Intronic
923151174 1:231234801-231234823 TCCAGCTCCTTGAACACACCAGG + Intronic
1063393459 10:5665290-5665312 TTCAGCTTATTCATTACACTGGG + Intronic
1063849612 10:10171480-10171502 TTTAACTTCTTTAATACACATGG + Intergenic
1066209284 10:33221092-33221114 TTCAGCCTCTTGAATACATGTGG - Intronic
1068218982 10:54019130-54019152 TTCTGCTTCCTGAATAGACTTGG - Intronic
1069691069 10:70353115-70353137 CACAGCTTCTGGAACACACCTGG - Intronic
1070416691 10:76197060-76197082 TTCAGCTATTGGAAGACACCTGG + Intronic
1071137914 10:82472828-82472850 TTCTTATTCTTGAAAACACCAGG + Intronic
1071217642 10:83426541-83426563 TTCAGCTGCTTGTATACAGATGG - Intergenic
1071236877 10:83659002-83659024 TTCAGCTTCTAGGATACATTTGG + Intergenic
1072684859 10:97530167-97530189 TTGAGCTTCTAGTATGCACCAGG - Intronic
1074610682 10:115018115-115018137 TGCTGTTCCTTGAATACACCAGG + Intergenic
1077613917 11:3661609-3661631 CTCAGCCTCTTGATTACAGCTGG + Intronic
1080043088 11:27779756-27779778 GTCTGCTTCTTGAATACCTCAGG - Intergenic
1080894708 11:36439579-36439601 TTCAGCTAATTGAATAAAGCAGG - Intronic
1080924062 11:36737712-36737734 CTCAGCTCCTTGAACACTCCAGG + Intergenic
1081630632 11:44687210-44687232 TTCAGCATCATGAATAGAACTGG - Intergenic
1083329737 11:61891807-61891829 TCCAGGTTCTTGACTCCACCCGG + Intronic
1084949959 11:72659385-72659407 TTCATCTCCTTGCAGACACCTGG + Intronic
1093152652 12:15641239-15641261 TTCATCTTCTTGAATATATAAGG - Intronic
1093250434 12:16796584-16796606 TTCAACTTCTTGAACACAGCAGG + Intergenic
1095112060 12:38307026-38307048 TTCAGCAACTTCAATTCACCAGG - Intergenic
1098528981 12:71519166-71519188 TGCAGCTTCTGGACCACACCAGG + Intronic
1099865520 12:88275647-88275669 ATTATCTTCTTGAATACTCCAGG + Intergenic
1100027839 12:90151496-90151518 TTCTGTTTCTAGAGTACACCAGG + Intergenic
1103979836 12:124729669-124729691 CTCTGCTTCCTGAGTACACCAGG - Intergenic
1104326759 12:127805990-127806012 TTCAGCTTGTTCTACACACCAGG - Intergenic
1104328004 12:127818447-127818469 TTCAGCTTCTGGAATAGAGGAGG - Intergenic
1107610125 13:42104546-42104568 TTCATCCTCTTAAAGACACCTGG - Intronic
1114763848 14:25348373-25348395 TTCAGCCTGTTGCAAACACCAGG + Intergenic
1114806737 14:25846428-25846450 CCCGGCTTCTTGCATACACCAGG - Intergenic
1115274659 14:31593856-31593878 TGCAGCTTCTTAAACACACAAGG - Intronic
1115506692 14:34099975-34099997 TTCAGCTTCTGGAACCCACTTGG - Intronic
1115795927 14:36935626-36935648 GTCATCTCCTTGAATATACCAGG + Intronic
1118075024 14:62288769-62288791 TTGAGCATCTAGTATACACCAGG + Intergenic
1121486504 14:94320683-94320705 TTCTGCTTTTGGAACACACCAGG - Intronic
1121688827 14:95859853-95859875 TCCAGCTTCTTATATACACTGGG - Intergenic
1122646446 14:103197527-103197549 TTCAGAGTCGTGAATACTCCTGG - Intergenic
1123154897 14:106214868-106214890 TGCAGCTACTTGAATGCAGCTGG + Intergenic
1124402562 15:29362280-29362302 TGCATCATCTTGAATTCACCTGG - Intronic
1126000823 15:44208026-44208048 TTCGTCTTCTTGGAAACACCTGG - Intergenic
1126770433 15:52050825-52050847 CTCAGATTCATGAATGCACCAGG - Intronic
1128491278 15:68148286-68148308 CTCAGCTTCTTGTAAAAACCAGG - Intronic
1128701178 15:69805470-69805492 TTCAGCTTCCTGGATGCACAGGG - Intergenic
1129363603 15:75040775-75040797 TTCAGCTTCCCGAATATAGCTGG + Intronic
1130052806 15:80497947-80497969 TTCAGCTTCTTGCAAACACTTGG - Intronic
1130128064 15:81110898-81110920 TTCAGCTTCTAGCAGACCCCTGG - Intronic
1134170432 16:11964157-11964179 TGCAACTTCTGGGATACACCAGG + Intronic
1134851580 16:17483202-17483224 TTCAGTTTCTTAAATACGCCAGG + Intergenic
1137034949 16:35561954-35561976 TTGAGATTCTGGAATATACCTGG - Intergenic
1138929732 16:61638362-61638384 TTATGTTTCCTGAATACACCTGG - Intergenic
1139239047 16:65371494-65371516 TACAGCTTCTTAAATAAGCCTGG + Intergenic
1139318073 16:66090404-66090426 TTGAGCATCTTCTATACACCAGG - Intergenic
1140944086 16:79751259-79751281 TTCAGCTTCTGGAGTCTACCTGG - Intergenic
1146468502 17:33106151-33106173 TGCTGCTTCTTGAATATTCCAGG - Intronic
1150992083 17:70271374-70271396 TACAGATTCTTAAATAAACCTGG + Intergenic
1151467664 17:74298008-74298030 TTCAGATTATGGAATAGACCCGG + Intronic
1155844953 18:30694801-30694823 TTCAGCCTCTCCAATACATCAGG - Intergenic
1159874191 18:73792067-73792089 TTCAGATTCTTTGAGACACCAGG + Intergenic
1164107861 19:22124708-22124730 ATCAGCTTCTCGAATTCACCTGG + Intergenic
1164623671 19:29713103-29713125 CTCAGCTTCCTGAATTCTCCAGG + Intronic
1166594045 19:44028675-44028697 TTCAGCACCTAGAATACTCCTGG + Intronic
1167723417 19:51194643-51194665 TTCAGGTTCTTGACTTCACTAGG + Intergenic
1167784139 19:51623505-51623527 TTCATCTTCTATAAAACACCTGG - Intronic
926234850 2:11032810-11032832 TTCAGATTCTTGACTATATCAGG - Intergenic
926235016 2:11034517-11034539 TTCAGCAACTTGAATAGAGCTGG - Intergenic
926754285 2:16223173-16223195 ATCAGCTTCTTGAAAACAAGAGG + Intergenic
927007104 2:18862095-18862117 GGCAACTTATTGAATACACCTGG + Intergenic
929030624 2:37647125-37647147 TTCAGCTCCTTAAATACAACTGG + Intronic
929178497 2:39007175-39007197 TTCAGTTTCTACAATACATCTGG + Exonic
929477140 2:42262479-42262501 TTCAGCTTCTTGAGGTCTCCTGG + Intronic
930049226 2:47201389-47201411 TTCTGTTTCTTGAAAACACCAGG - Intergenic
932209691 2:69916106-69916128 TTCAGCTTCTAGAAAACAGGAGG - Exonic
932528088 2:72494740-72494762 TTCAGCTTCTTAATTAGACTAGG + Intronic
933486246 2:82927810-82927832 TTAAGCCTCTTGAATGCACTGGG + Intergenic
935462355 2:103353247-103353269 TTCATTTTCTTTAAAACACCTGG + Intergenic
940340758 2:152578278-152578300 TACAGATTTTTGACTACACCAGG - Intronic
942640493 2:178056215-178056237 TCCATCTTCCTGAATCCACCAGG - Intronic
942686714 2:178540285-178540307 TTCATCTTCTGGAACACTCCAGG + Exonic
943238212 2:185349075-185349097 TTAATCTTCTTGAAAACACTAGG + Intergenic
944403606 2:199356948-199356970 TTCAGCTTCTTTAATAAAGTAGG - Intronic
944936833 2:204578370-204578392 TTCATCTTCTGGAATATAGCTGG + Intronic
945141358 2:206690265-206690287 TGCTGCTCCATGAATACACCAGG - Intronic
946524700 2:220505918-220505940 TTCAGCTTCTTCATTCCAGCTGG + Intergenic
947988148 2:234466162-234466184 TGCAGTTTATTGAATTCACCTGG - Intergenic
1169030466 20:2402851-2402873 TTCTGCTCCTTGAACACACAAGG + Intronic
1169403254 20:5301910-5301932 TTCAGCTTCTTGAGGGCACGGGG + Intergenic
1173148903 20:40549286-40549308 CTTAGCTTCTTGACCACACCAGG + Intergenic
1174193018 20:48753702-48753724 TTTTGTTTCTTGAACACACCAGG + Intronic
1177066158 21:16438932-16438954 TTCAGCTTATTCAATAAGCCAGG - Intergenic
1177473450 21:21588485-21588507 TTCATCTTCATTAATACACTTGG - Intergenic
1179021072 21:37641661-37641683 TTCAGCTTCTTGAACACCCAAGG - Intronic
1182049847 22:27304332-27304354 TTCAGGTTGTTGACTACACAAGG + Intergenic
951691259 3:25398670-25398692 TTAAGCTTCTGGAACCCACCTGG - Intronic
951857540 3:27214456-27214478 TTCAGCTTCTTGCTTACAGGAGG - Intronic
955004608 3:54957041-54957063 TTAAGCTTCTAGCAGACACCTGG + Intronic
957472589 3:80678728-80678750 TTGAGCTTCTTTTATAAACCAGG + Intergenic
958620897 3:96558285-96558307 TTCAATTTCTTGAATAGACTGGG - Intergenic
962775560 3:138656059-138656081 TTCAGCCACTTGAATAAAACAGG + Intronic
966647814 3:182266556-182266578 TGCTGCTCCTTGAAAACACCAGG + Intergenic
967450264 3:189615240-189615262 TTCAGTCTCTTGAATATTCCTGG + Intergenic
969319291 4:6402129-6402151 TTCATCGCCTTGAATCCACCTGG + Intronic
969615899 4:8252459-8252481 TCCTGCTTCTCGAATCCACCAGG - Intergenic
969723750 4:8907367-8907389 TTCAGCTACATGAATAGACAAGG + Intergenic
970150515 4:13084416-13084438 TTCAGCATCTGAAATGCACCAGG + Intergenic
970167233 4:13251691-13251713 TTAGGCTTCTGGAGTACACCAGG - Intergenic
970606967 4:17690187-17690209 TTAAGCTGCTTGAATGCCCCTGG - Intronic
970887297 4:21001163-21001185 TTTACCTTCATGAATACACATGG + Intronic
972388809 4:38593241-38593263 TTCTGCTCCTTAAAGACACCAGG - Intergenic
975173501 4:71260142-71260164 TTCAGTTTCCTGAATATAACTGG - Intronic
975527768 4:75369795-75369817 TTCATCTTATTGACTACAACTGG + Intergenic
975704036 4:77094084-77094106 TTCAGATTCTGGAATAGAACAGG - Intergenic
975706874 4:77120523-77120545 TGCTGCTACTTGAAGACACCAGG - Intergenic
976179744 4:82387616-82387638 CTCAGCTTCTTTAATTCACATGG - Intergenic
976795577 4:88928996-88929018 TTCACCATCATGAAAACACCTGG - Intronic
980256783 4:130391417-130391439 TTTATATTCTTGAATACAGCTGG - Intergenic
981014660 4:139961371-139961393 TTGAGCTTTTTGAAAACATCTGG - Intronic
981036704 4:140176926-140176948 TTCAGCTTCTTGGACATACCGGG + Intergenic
981328300 4:143477631-143477653 TACAGCTTCTTAAATACAGGAGG - Intergenic
983429228 4:167626631-167626653 TGCCGCGTCGTGAATACACCAGG + Intergenic
983714232 4:170757234-170757256 TTCAGCTACTTGGAAACAGCAGG - Intergenic
985085389 4:186307919-186307941 TTCAGCTTCATGCATTTACCTGG + Intergenic
986669579 5:10131113-10131135 TTCAGCTTCTGGAATGCCCAGGG - Intergenic
987508051 5:18798546-18798568 GTAAGGTTCTTTAATACACCTGG - Intergenic
987516025 5:18909434-18909456 TTCAGCTTATTGAAGATTCCTGG + Intergenic
990270889 5:54137544-54137566 TTCAGCTTCTCTAATAAACCTGG + Intronic
990962930 5:61413955-61413977 TTCAGTTATTTGAATACATCAGG - Intronic
991151174 5:63372569-63372591 TTCTGCTTATTTAATACACAGGG + Intergenic
991270719 5:64776373-64776395 TTCTGCTTCTTCCATTCACCTGG - Intronic
995061962 5:107820879-107820901 TACAGCTTCTTTTAGACACCTGG + Intergenic
995530746 5:113089668-113089690 TTCAGTTCCTTGAGTACACCAGG - Intronic
995815340 5:116161336-116161358 TTCAGCTTCTATTATACAGCCGG - Intronic
996339960 5:122425802-122425824 TTAAGCTTCTTAACCACACCTGG + Intronic
999135308 5:149314885-149314907 TTCAGCTTCTTGAAGAAAGATGG + Intronic
1001410046 5:171505043-171505065 TTCAGTTTCCAGAACACACCAGG - Intergenic
1002048590 5:176556085-176556107 TTGAACTCCTGGAATACACCTGG + Intronic
1003006798 6:2389967-2389989 TGCAGCTTCCTGAATACAAAAGG + Intergenic
1003413289 6:5885213-5885235 CTCTGCTTCTGGAATACAGCTGG + Intergenic
1006011596 6:31046852-31046874 TTCAGCTTCTGGGATTCTCCTGG + Intergenic
1007932785 6:45707564-45707586 TTGAGCTCCTTGTATGCACCAGG + Intergenic
1013572518 6:111443641-111443663 GAGACCTTCTTGAATACACCAGG - Intronic
1014338329 6:120168685-120168707 TTGAACTTCTTGAATATAACAGG + Intergenic
1014853851 6:126375205-126375227 TTCTGTTTCTTGAACACACTGGG - Intergenic
1015364044 6:132376816-132376838 TACAGCTTCTTATATGCACCAGG + Intronic
1016499153 6:144699321-144699343 CTCAGCCTCCTGAATACAGCTGG - Intronic
1017073464 6:150597590-150597612 TTGAGCTCCTTGAAATCACCTGG - Intergenic
1020054201 7:5105762-5105784 TTCAGCCTCCTGAATAAACTGGG - Intergenic
1020360019 7:7318214-7318236 TGCTGTTTCTTAAATACACCAGG - Intergenic
1021561066 7:21969042-21969064 ATCAGCTTCTGGAAGACACTGGG - Intergenic
1022054251 7:26713117-26713139 TTCTGGTTCTTGAACACCCCAGG + Intronic
1027753223 7:82178491-82178513 TTGAACTTGTTGAACACACCTGG + Intronic
1030674809 7:112373475-112373497 TTCAGCTTCTCCAATATACTAGG + Intergenic
1036811332 8:11868941-11868963 CTGAGCCTCTTGAATACAACTGG - Intronic
1039194615 8:35017005-35017027 TTCAGCCTCTAGAATACTCTCGG + Intergenic
1040855338 8:51943082-51943104 TTCTGCTCCTTGAAAACTCCGGG + Intergenic
1041071993 8:54134660-54134682 TACAGCGTCTGGCATACACCAGG + Intergenic
1042689437 8:71481537-71481559 TTCAGCATCTTGCATAGTCCCGG - Intronic
1043886971 8:85612239-85612261 TTCAGCTTCTTAAATCCCCCAGG - Intergenic
1045851267 8:106701441-106701463 TTCAGCTCTGTGAATTCACCTGG - Intronic
1049343733 8:142127502-142127524 TTCAGCTTTTTGCACACTCCAGG - Intergenic
1049829141 8:144688603-144688625 CTCAGCCTCTTGACTACGCCTGG - Intergenic
1050010478 9:1181057-1181079 TTCAGCTCCTTGAATCAGCCAGG + Intergenic
1052271510 9:26632706-26632728 TCCAGCTTCTGAAATACACTAGG - Intergenic
1052327607 9:27232558-27232580 ATCAGCATATTTAATACACCAGG + Intergenic
1057024063 9:91722609-91722631 TTCACTTTATTGGATACACCGGG + Exonic
1059410096 9:114126579-114126601 TTGAGCTTCTTCTACACACCAGG + Intergenic
1060691289 9:125663260-125663282 TTCTATTTTTTGAATACACCAGG + Intronic
1188456687 X:30374212-30374234 TTCAGCTTCTTGGATGTAACTGG - Intergenic
1189127645 X:38464735-38464757 TTGAGCTTCTTAGATCCACCAGG - Intronic
1189551501 X:42098463-42098485 TTCAGCTTCTTAATTGCAGCTGG - Intergenic
1190157711 X:48007149-48007171 TTCAGCTTCTTTCATTGACCCGG - Intronic
1190173483 X:48130034-48130056 TTCAGCTTCTTTCATTGACCCGG - Intergenic
1193994750 X:88351767-88351789 TTCAGCAACTTGAATGGACCTGG + Intergenic
1194369657 X:93057059-93057081 TTCAGAATCTTGATTACCCCTGG + Intergenic
1197831859 X:130651487-130651509 TTCAGCTTCCTGAAAACCTCTGG + Intronic
1198139119 X:133785053-133785075 TTCAGGTCTTTGAATAAACCAGG + Intronic
1200677848 Y:6173268-6173290 TTCAGAATCTTGATTACCCCTGG + Intergenic