ID: 912228967

View in Genome Browser
Species Human (GRCh38)
Location 1:107770061-107770083
Sequence AAGGGGACTGAGCATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912228967_912228975 3 Left 912228967 1:107770061-107770083 CCCACCTCATGCTCAGTCCCCTT 0: 1
1: 0
2: 0
3: 21
4: 269
Right 912228975 1:107770087-107770109 TCATTCTGCTCCAGCCACACTGG 0: 4
1: 63
2: 190
3: 488
4: 1197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912228967 Original CRISPR AAGGGGACTGAGCATGAGGT GGG (reversed) Intronic
900458166 1:2787301-2787323 AAGGAGACTGAGGGTCAGGTAGG + Intronic
900838607 1:5027958-5027980 ATGGGGACTGGGCTTGGGGTTGG - Intergenic
901229595 1:7634383-7634405 AAGGGTGCTGAGCAGGAGGTCGG + Intronic
901770261 1:11526569-11526591 GAGGGGACGGAGCCTGAGGCTGG + Intronic
903427786 1:23267316-23267338 ACTGGGACTGAGGCTGAGGTGGG - Intergenic
903769044 1:25752711-25752733 AAGGGGTCTGAGCCTCAGGCAGG + Intronic
904473200 1:30748444-30748466 GAGGGGACTGAGCTTCAGGGAGG - Intronic
906192555 1:43907259-43907281 AACGGGACTGCACATGATGTTGG - Intronic
910326489 1:86013960-86013982 AAGGGGACTGTGCAGGAGAAAGG - Intronic
911014732 1:93320280-93320302 AAGCAGAATGAGCAAGAGGTGGG - Intergenic
912228967 1:107770061-107770083 AAGGGGACTGAGCATGAGGTGGG - Intronic
912705453 1:111908608-111908630 AGGGGGTCTGGGCAGGAGGTGGG - Intronic
916132507 1:161623725-161623747 AAGGGGACTGAGGATTGGGGTGG - Intronic
916315513 1:163444041-163444063 AAGAGGGCAGAGCATGAGGCAGG - Intergenic
916670848 1:167018866-167018888 AAAGGGATTGAGCATGAGAGAGG + Intronic
917236163 1:172893738-172893760 GAGGAGGCTGTGCATGAGGTGGG + Intergenic
919896181 1:202011098-202011120 AGGGGGAGAGAGGATGAGGTTGG - Exonic
920199416 1:204250342-204250364 AAGGGGGATGAGGAGGAGGTAGG + Intronic
920524001 1:206652390-206652412 AAGGGGCCTGTGGCTGAGGTTGG + Intronic
922557697 1:226545639-226545661 AAAAGGACTGAGAATGGGGTAGG - Intergenic
1062838331 10:650729-650751 CAGGGAAGTGAGCATGAGGGGGG - Intronic
1063415478 10:5869609-5869631 AAGGGTGCTGAGCAGGAGCTGGG - Intronic
1066616817 10:37303204-37303226 AATGGGGCTGTGCATGAGATGGG - Intronic
1067780585 10:49202344-49202366 AAAGAGACTGAGTGTGAGGTAGG + Intergenic
1070655795 10:78270209-78270231 AAGGGGACCAAGCATGGGGATGG + Intergenic
1072192636 10:93088868-93088890 AAGGGCACAGAGCTTGATGTGGG + Intergenic
1073209237 10:101785202-101785224 AAGGGTTCTGAGCATGAAGCTGG - Exonic
1074547127 10:114409693-114409715 CAGAGGATTGAGCATGAGCTAGG - Intergenic
1075090914 10:119443851-119443873 CAGGGGTCTGAGCATGGGGGTGG + Intronic
1075099934 10:119499082-119499104 AAGGGAACTGAGCCTGACCTTGG + Intergenic
1075214748 10:120522426-120522448 AAGGGCACTGAGGATCAGGCAGG + Intronic
1075399520 10:122150910-122150932 CAGGGGAAGGAGCATGAAGTTGG + Intronic
1075709048 10:124521045-124521067 AAGGGGACAGTGCAGGAGGAGGG - Intronic
1076442344 10:130488606-130488628 AAGGGGATTGAGGAAGAGGCAGG + Intergenic
1076839831 10:133040561-133040583 AGGGGGGCTGAGGGTGAGGTGGG + Intergenic
1078814796 11:14809649-14809671 GAGATGACTAAGCATGAGGTTGG + Intronic
1080832294 11:35906835-35906857 GAGGGGACTTAGCATGAGAATGG - Intergenic
1084084316 11:66847905-66847927 AAGGGAACTGAGCAGGAGTCTGG + Intergenic
1085325967 11:75606808-75606830 AAGGGGACAGAGCTAGAGGAGGG - Intronic
1086217884 11:84405736-84405758 AAGGGGACTAGGAATGTGGTGGG + Intronic
1086262882 11:84961858-84961880 AAGTAGACTGGGCATGAAGTGGG - Intronic
1087217222 11:95507105-95507127 AAGGGTACAGAGCATAGGGTAGG + Intergenic
1087277647 11:96176446-96176468 CAGGGGACTCATCTTGAGGTAGG + Intronic
1088305104 11:108399379-108399401 AAGGGGAAAAAGCCTGAGGTAGG - Intronic
1089707015 11:120285617-120285639 AAGAGGACTGAGCATGAACAGGG - Intronic
1090732229 11:129581730-129581752 AAGGGCACTGCGCATTAGATAGG + Intergenic
1093090037 12:14910725-14910747 GAGGGGACTGGGCAGGAGGCTGG - Intergenic
1093517965 12:20013368-20013390 ATGGGGACTGAGGTTGAGGAGGG - Intergenic
1094115234 12:26904150-26904172 AAGAGGACTGAGAATGAGACAGG + Intergenic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1095825517 12:46526437-46526459 GAGGGGACAGAGCAGGGGGTAGG - Intergenic
1096248030 12:50006567-50006589 CAGAGGACTGACCATGAGCTGGG - Exonic
1097438173 12:59576475-59576497 ATGTGTACTGAGCATGAGGGAGG + Intergenic
1100353157 12:93803799-93803821 AAGGGTACTGATCTTGAGATTGG + Intronic
1102699049 12:114823373-114823395 AAGGTCACACAGCATGAGGTGGG - Intergenic
1105945942 13:25189503-25189525 CAGGGGAGTGATCAAGAGGTTGG + Intergenic
1106025391 13:25950927-25950949 AAAGGGAGTGTGCATGAGGTGGG - Intronic
1106081067 13:26500752-26500774 AAGGGGAATGGGCATCTGGTTGG - Intergenic
1106721429 13:32438960-32438982 AAGGCCACTGACCATGAGCTTGG + Intronic
1107601567 13:42018729-42018751 AATGGGACTGAACATAAGTTAGG - Intergenic
1107947981 13:45436946-45436968 GAGGGGACTGTGGGTGAGGTGGG - Intergenic
1108321062 13:49291025-49291047 AAGGGGACTGTGTGTGGGGTAGG - Intronic
1110192911 13:72751937-72751959 AGGGGGACTGAGAATGATGAGGG + Intronic
1110994062 13:82082693-82082715 AAGGAGACTGAGTGAGAGGTGGG - Intergenic
1112349051 13:98617730-98617752 AAGCGGACAGATCATGAGGACGG + Intergenic
1112395542 13:99027424-99027446 AGTGGGCCTGAGCATGAGGATGG - Intronic
1115788080 14:36848477-36848499 ACAGGGACTGAGCAAGAGGGAGG + Intronic
1116529769 14:45955805-45955827 AAGTGGACTGAGGACGAGGATGG - Intergenic
1116892139 14:50279377-50279399 GTGGGGGCTGGGCATGAGGTGGG + Intronic
1117145804 14:52835893-52835915 AAGGGTACTGGGCCTGGGGTGGG + Intergenic
1117943375 14:60992619-60992641 CTGGGGACTGAGTGTGAGGTGGG + Intronic
1117954315 14:61110996-61111018 AAAGAGACTGAGCCTGAGTTGGG - Intergenic
1118913953 14:70085544-70085566 AATGGGACTGGGCATGTTGTAGG - Intronic
1120656551 14:87197133-87197155 AAGGGGAGTGGGCAAGAGGTGGG + Intergenic
1123112587 14:105880202-105880224 AGGGGGACTGGGCAGGGGGTAGG + Intergenic
1124368140 15:29088421-29088443 AAGAGGACTGAGCTTGGGTTGGG - Intronic
1125496281 15:40197476-40197498 AAGGGTACAGAAAATGAGGTAGG + Intronic
1125769273 15:42154238-42154260 AGGAGGTCCGAGCATGAGGTAGG + Intronic
1126325851 15:47476577-47476599 AAGGAGATAGAGCATGAGGAAGG - Intronic
1127123594 15:55791619-55791641 GAGGTGACTAAGCATGAGGGAGG - Intergenic
1130030492 15:80308947-80308969 ATTGGGACTGACCAGGAGGTTGG - Intergenic
1130769972 15:86914479-86914501 AAGTGGAGGGAGCATGAGTTAGG - Intronic
1133441816 16:5827706-5827728 AAGGGGACTTAGAATTAGGAAGG - Intergenic
1134168097 16:11946459-11946481 AAGGAGGCTGAGGCTGAGGTGGG + Intronic
1136633267 16:31502176-31502198 GAGGGCACTGACCCTGAGGTGGG + Intronic
1136922362 16:34343762-34343784 AGGGGTGCTGAGGATGAGGTGGG - Intergenic
1136982211 16:35068044-35068066 AGGGGTGCTGAGGATGAGGTGGG + Intergenic
1137273814 16:46920251-46920273 AAGGGGAAAGAGCAGGAGTTTGG + Intronic
1138339863 16:56281569-56281591 AAGGGGACTGAGAAGGAGGGAGG - Intronic
1138836439 16:60441712-60441734 AAGGGGATTGAGCATAAACTAGG + Intergenic
1139085402 16:63579007-63579029 AAAAGTACTGAGCATGTGGTAGG + Intergenic
1140743522 16:77962175-77962197 AAGGGGACTGACCACGGGCTGGG - Intronic
1143301102 17:5911217-5911239 AAGGGGACTGGCCTTGAGCTGGG + Intronic
1143728839 17:8868403-8868425 GAGGGGATAAAGCATGAGGTTGG - Intergenic
1145964259 17:28905843-28905865 AGGGGGAGGGAGCAGGAGGTGGG + Exonic
1146061727 17:29611435-29611457 AAGGTGCCTGAGTATGTGGTTGG + Intronic
1147627398 17:41908990-41909012 AAGGGGATTGATCTCGAGGTAGG + Exonic
1149713682 17:58766428-58766450 AGGCGGACAGAACATGAGGTCGG - Intronic
1151575075 17:74949120-74949142 AAGAAGACTGAGCGGGAGGTGGG + Intronic
1151751205 17:76039059-76039081 ACGGGGACTGGACATGAGGGAGG + Intronic
1152474714 17:80510478-80510500 AAGTGGGGTGAGCATGAGGAAGG - Intergenic
1153110569 18:1581303-1581325 AAGGGGACTCAGCATCAGAAAGG - Intergenic
1153393354 18:4589657-4589679 AAGGGCACTGAGTAGGAGGGGGG + Intergenic
1156486767 18:37471425-37471447 GACGGGACTTAGCATGAGTTGGG - Intronic
1156660276 18:39338246-39338268 AAGGGCACTTAGCAGGAGGTTGG - Intergenic
1157512731 18:48290307-48290329 ACTGGGACTGAGAAGGAGGTGGG - Intronic
1157513694 18:48296178-48296200 AGGGGGCCTGAGCAGGTGGTGGG - Intronic
1160544026 18:79641047-79641069 ACGGGGACAGAGCTTCAGGTTGG - Intergenic
1160997815 19:1892228-1892250 GAGGGGACTGAGCATGGAGACGG - Intergenic
1161883054 19:6971164-6971186 AACAGAACTGAGCCTGAGGTAGG - Intergenic
1162365056 19:10243541-10243563 GAAGGTACAGAGCATGAGGTCGG - Intergenic
1163606422 19:18278311-18278333 AAGGGAACTGAGGCTGAGGTGGG - Intergenic
1163875737 19:19866122-19866144 AAGGGGACTGAGGCCGAGCTGGG - Intronic
1163906260 19:20151658-20151680 AAGGGGACTGAGGCCGAGCTGGG + Intergenic
1163908349 19:20167480-20167502 AAGGGGACTGAGGCCGAGCTGGG - Intronic
1163919606 19:20276297-20276319 AAGGGTACTGAGGCTGAGCTGGG + Intergenic
1164017978 19:21269625-21269647 AAGGGGACTGAGGCTGAGATGGG + Intronic
1164023414 19:21329063-21329085 AAGGGGACTGAGGCCGAGCTAGG + Intronic
1164064780 19:21706470-21706492 CAGGGGAGTGAGGATGAGCTGGG + Intergenic
1164115520 19:22215494-22215516 AAGGGGACTGAGGTCGAGCTAGG + Intergenic
1164136545 19:22422045-22422067 AAGGGGACTGAGGCCGAGCTAGG + Intronic
1164162213 19:22634602-22634624 AAGGGGACTGAGGCTGGGCTGGG - Intronic
1164213100 19:23117300-23117322 AAGGGGACTGAGGCCGAGCTGGG - Intronic
1164241718 19:23395176-23395198 AAGGGGACTGAGGCCGAGCTGGG + Intronic
1164254143 19:23512365-23512387 AAGGGGACTGAGGCCGAGCTGGG + Intergenic
1164315853 19:24087448-24087470 AAGGGGACTGAGGTCGAGCTGGG - Intronic
1164415515 19:28043876-28043898 AAGTGGAATGATCCTGAGGTGGG - Intergenic
1164415747 19:28045328-28045350 AAGTGGAATGATCACGAGGTGGG - Intergenic
1165952234 19:39480910-39480932 GCGGGGACTGTGCACGAGGTTGG + Exonic
1166661822 19:44652302-44652324 CAGGAGACTGAGGCTGAGGTGGG - Intronic
1166840697 19:45695385-45695407 ACGGGGACTGGGGAGGAGGTGGG - Intronic
1167628400 19:50607525-50607547 CAGGGGACTGAGAAAGAGGATGG - Intergenic
1168709626 19:58491523-58491545 AAGGGCACTGGGCATGGTGTGGG + Intronic
926775837 2:16422275-16422297 AAGGGGACTGGGCAAGAGTGTGG - Intergenic
927574717 2:24191369-24191391 GATGGGACTGAGCAGGAGCTGGG - Exonic
927702298 2:25276223-25276245 CAGGGGCCTGAGCATGGGGCAGG - Intronic
929429541 2:41875433-41875455 AATGTGACTGAGCAGGAGGGAGG - Intergenic
929819933 2:45264829-45264851 AAGGGGACAGAGCAAGTGGAAGG - Intergenic
930883389 2:56297265-56297287 AAGAGGACTGTGGATGAGTTGGG + Intronic
932631092 2:73344122-73344144 CTGGGGAGTGAGGATGAGGTGGG + Intergenic
932840026 2:75073447-75073469 AAGGGGACCATACATGAGGTTGG + Intronic
933031604 2:77335332-77335354 AAGGTGACTGAACAAGAGGAAGG - Intronic
933949486 2:87315760-87315782 AAGGGAACTGAGGATCAGGTTGG - Intergenic
934586457 2:95502320-95502342 AAGGGCATTAAGCATGTGGTGGG + Intergenic
935081462 2:99800959-99800981 AAGGGGTCTGAGAATGAATTTGG + Intronic
935412964 2:102785227-102785249 AAGGGGACTGAGGAGGAGTGGGG - Intronic
936330707 2:111545837-111545859 AAGGGAACTGAGGATCAGGTTGG + Intergenic
936750520 2:115635516-115635538 AATGGGACTGAGTAGGTGGTTGG - Intronic
937023591 2:118679842-118679864 AAGGAGACTGGGCATCAGGGAGG + Intergenic
937135649 2:119549890-119549912 AAGGGGACCCAGCAAGAGTTGGG - Intronic
937144134 2:119627858-119627880 GAAGGGACTGAGACTGAGGTAGG - Intronic
937877624 2:126837303-126837325 AAGGGGACAGAGCCTGGGGCTGG + Intergenic
939409517 2:141805989-141806011 AAGGGGAATGGGCAGGAAGTAGG + Intronic
940491024 2:154360932-154360954 AAGGGGAGTGAAGATGGGGTTGG + Intronic
940783125 2:157954198-157954220 CAGGAGACTGAGGTTGAGGTTGG + Intronic
941606915 2:167609416-167609438 AAGGAAACAGAGCATAAGGTAGG + Intergenic
941684667 2:168436289-168436311 AAGTGGGCAGATCATGAGGTTGG + Intergenic
943405429 2:187477435-187477457 AAGTGGACTGTGGATGAAGTGGG + Intronic
945193738 2:207218001-207218023 AATGGCACAGAGCATGATGTTGG - Intergenic
1168867138 20:1096622-1096644 AAGGGGAGGGAACATGAGGAGGG - Intergenic
1170433248 20:16296636-16296658 AATGGGGCTGCACATGAGGTGGG + Intronic
1171121323 20:22571493-22571515 CAGAGGCCTGAGCCTGAGGTAGG + Intergenic
1171796096 20:29567764-29567786 AAGGGGCCACAGGATGAGGTGGG - Intergenic
1172120708 20:32597082-32597104 AAGGGGACTGAGCTGGGGGTAGG - Intronic
1172486967 20:35304163-35304185 AAGGGGACGGGGCATGAGGGGGG + Intronic
1172872890 20:38146914-38146936 ACGGGGACTGAGCCTGGGATGGG + Intronic
1172957282 20:38769889-38769911 AAGGGGCATGAGCATGGGGCTGG + Intronic
1173160639 20:40649660-40649682 AAGTGGACTGAGGATGATGATGG + Intergenic
1174486334 20:50863724-50863746 AAGGGGACGGATCTGGAGGTTGG + Intronic
1176075635 20:63247141-63247163 AAGTGGACAGAGCCTGAGGCTGG - Intronic
1176966955 21:15222128-15222150 AAGAGAACTGAGCAGGATGTAGG + Intergenic
1180155825 21:45977097-45977119 ATGAGGATGGAGCATGAGGTGGG - Intergenic
1181438832 22:22925296-22925318 AAGGGGACGGGGCCTCAGGTTGG + Intergenic
1183138485 22:35913848-35913870 AAGGGGAATGAGGAAGGGGTGGG + Intronic
1183194017 22:36340826-36340848 GAGGGGAGTGACCAGGAGGTGGG + Intronic
1183285619 22:36960890-36960912 AAGTGGAATGAGAATGAGGGTGG - Intergenic
1183569033 22:38638274-38638296 CAGAGGACTGAGCAGGAAGTGGG + Intronic
1184331495 22:43830687-43830709 AAGATGACTGAGGATGAAGTGGG + Intronic
950185484 3:10942754-10942776 CAGGGGACTGATTATGAGATGGG - Intergenic
950261343 3:11544974-11544996 AAGAGGGCTGAGAATAAGGTAGG + Intronic
950849396 3:16048429-16048451 AAGGGGGCAGAGCAAGAAGTGGG - Intergenic
952461647 3:33532931-33532953 AACGTGACAGAGCATCAGGTTGG + Intronic
954990111 3:54833375-54833397 AAGGGGTAGGAGCAGGAGGTGGG - Intronic
956561723 3:70585020-70585042 CATGGTACTGAGCATAAGGTTGG - Intergenic
957309626 3:78503042-78503064 AAAGGGAATGAGTATTAGGTGGG - Intergenic
960946115 3:122967833-122967855 AGGAGGACTGAGAAGGAGGTAGG + Intronic
961049978 3:123737786-123737808 AAGGAGCCTGAGTTTGAGGTAGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
963060002 3:141217771-141217793 AAGGGGACAGAGTAGGAAGTGGG - Intergenic
963624858 3:147658634-147658656 TAGGCCACGGAGCATGAGGTGGG - Intergenic
965678058 3:171220522-171220544 GAGGGGAATGAATATGAGGTGGG + Intronic
966504002 3:180679024-180679046 AAGAGGAGTGGGCATGAGGAAGG + Intronic
967194242 3:187012798-187012820 AAGAGGTCTAAGCATGAGGGTGG + Intronic
967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG + Intronic
969121781 4:4916193-4916215 AATGGAACTGTGCAGGAGGTGGG - Intergenic
969240643 4:5894734-5894756 AAGGGGTCTGTGCAGCAGGTAGG + Intergenic
969294523 4:6262012-6262034 CAGGGAACTGAGCATGGGGAGGG - Intergenic
969493066 4:7510833-7510855 AGGAGGACAGAGCATGATGTTGG - Intronic
971178061 4:24300644-24300666 AAGGGGAGTGAATATGAGGGAGG - Intergenic
971237353 4:24854763-24854785 CAGGGAGGTGAGCATGAGGTGGG - Intronic
971581891 4:28352106-28352128 ATGGGCACTAAGGATGAGGTTGG - Intergenic
972954796 4:44375997-44376019 AAGGGGAGTGATTATGTGGTTGG + Intronic
973553429 4:52057983-52058005 AAGTGGACGGAGAATGAGCTTGG - Intronic
976874898 4:89841077-89841099 AAAGGGGGTGAGCATGAGATGGG + Intergenic
986968869 5:13308324-13308346 AAGGGAACTGAGGGTGAGGCAGG - Intergenic
987318580 5:16747128-16747150 AAGGGCCCTGAACCTGAGGTGGG + Intronic
988082413 5:26430783-26430805 ATGGGGGCTTACCATGAGGTAGG + Intergenic
990342780 5:54840354-54840376 AATGGGAGGGAGCATGAGCTAGG - Intergenic
990461786 5:56037549-56037571 CAGTGAACTGAGGATGAGGTTGG + Intergenic
995847494 5:116509735-116509757 AAGGGGACCCAGGCTGAGGTGGG + Intronic
996840043 5:127837757-127837779 AAGTGGGCAGATCATGAGGTCGG + Intergenic
997725703 5:136118312-136118334 AAGGGGGCAGGGCGTGAGGTGGG - Intergenic
997823837 5:137089048-137089070 AAGGGGGCTGAGCAGGAGAATGG + Intronic
998229167 5:140348435-140348457 AATGGGACTGAGGCTGATGTGGG - Intergenic
998801324 5:145872628-145872650 AAGGCGAATGACCATAAGGTTGG - Exonic
999084183 5:148872642-148872664 AAGGAGAAAGAGCATGAGATCGG + Intergenic
999399382 5:151252884-151252906 AAGGGAGCTTAGCACGAGGTTGG - Exonic
1000140674 5:158400313-158400335 AAGGGGACTGGGCATGAAGGAGG + Intergenic
1002560253 5:180076845-180076867 AAGGGGCAGGAGCAGGAGGTGGG - Intergenic
1002695496 5:181085722-181085744 AAGTGGATTTAGCCTGAGGTGGG - Intergenic
1002716870 5:181233606-181233628 AAGGGGACCGGGCAGGGGGTGGG - Intronic
1003891188 6:10565187-10565209 AGCTGGACTGAGCATGAGGCAGG + Intronic
1004180161 6:13374406-13374428 AAGGAGACTGAGCAGGAGAATGG - Intronic
1005512264 6:26521676-26521698 ACGGGGAGTAAGGATGAGGTGGG - Intergenic
1006173746 6:32109696-32109718 AAGGGGGCTGGCCATGAGGAAGG - Intronic
1006202950 6:32313086-32313108 AAGGAGGCAGAGCAGGAGGTAGG - Intronic
1006203607 6:32319566-32319588 AAGGAGGCAGAGCAGGAGGTAGG - Intronic
1008621910 6:53279036-53279058 AAGGGGAAAGAGCATGGGTTTGG + Intronic
1008870843 6:56270791-56270813 CAGGAGACAGAGCATGAGGGAGG - Intronic
1018366846 6:163129739-163129761 AAGGAAACTGAGTGTGAGGTTGG - Intronic
1019658971 7:2213207-2213229 CATGGGCCTGAGCATCAGGTAGG - Exonic
1019719650 7:2560280-2560302 AAGGAGACTGAGCAGAAGATGGG + Intronic
1022171884 7:27839091-27839113 AAGGGGATGGAGCTGGAGGTGGG + Intronic
1022240993 7:28512318-28512340 GAGAGGTCTGAGCATGAGCTGGG + Intronic
1023396867 7:39759562-39759584 AAGGGGACTAGGGATGGGGTAGG - Intergenic
1023806313 7:43875422-43875444 AAGTGGGCTGTGGATGAGGTCGG + Intronic
1024096535 7:45987042-45987064 AAGAGGACTGAGAATGTGGCTGG + Intergenic
1025167564 7:56726177-56726199 AAGTGGGCAGATCATGAGGTCGG - Intergenic
1026234257 7:68512234-68512256 AAGTGGACAGATCATGAGGTAGG + Intergenic
1027411521 7:77924822-77924844 AAGGGAACTGGGGATGAGATGGG + Intronic
1027661617 7:80994615-80994637 AGGGGGGCGGATCATGAGGTCGG - Intergenic
1028729012 7:94123483-94123505 CAGGAGACTGAGCATGACATGGG - Intergenic
1029576893 7:101409335-101409357 AAGTGGATGGAGCATGGGGTTGG + Intronic
1030800302 7:113841992-113842014 ATGGGCACAGAGCATGAGGAGGG - Intergenic
1031458740 7:122018207-122018229 AAGATGACTGAGCATGAGAACGG - Intronic
1033366469 7:140675830-140675852 AAGGGCCCTGAGCATGAAGGAGG - Intronic
1033415627 7:141158957-141158979 AAGGGAAATGAGGAAGAGGTTGG + Intronic
1036401238 8:8410344-8410366 AAGGGCACTGAGCAACTGGTTGG - Intergenic
1036678933 8:10856627-10856649 AACAGCACTGAGCATGATGTGGG + Intergenic
1036702189 8:11020080-11020102 AAGGGGACTGGGCCTTGGGTGGG - Intronic
1037389841 8:18381601-18381623 ATTGGGAATGAGCATGAGCTGGG - Intergenic
1037726042 8:21483255-21483277 GAGGGGGCTGAGCTTGAGTTGGG - Intergenic
1039927134 8:41945498-41945520 AAGTGGGCAGATCATGAGGTCGG - Intronic
1041313111 8:56536385-56536407 GAGGCCACTGAGCAAGAGGTTGG - Intergenic
1042548319 8:69971024-69971046 AGGCGGGCTGATCATGAGGTCGG - Intergenic
1042569770 8:70150520-70150542 TAGTGGAGTGATCATGAGGTGGG - Intronic
1045315299 8:101038797-101038819 AAGTGATCTGAGCATGAGGTTGG + Intergenic
1047558953 8:125965686-125965708 AAGGAAACTGAGAGTGAGGTTGG - Intergenic
1047612721 8:126536950-126536972 TAGGAGACTGAGACTGAGGTGGG - Intergenic
1048293755 8:133199471-133199493 AAGAGGACTTAGAAAGAGGTTGG + Intronic
1049632421 8:143665767-143665789 AAGGGGGATGGGGATGAGGTGGG + Intergenic
1050469123 9:5966686-5966708 AGGGGGGCAGATCATGAGGTCGG - Intronic
1052643308 9:31197857-31197879 ATGGTGACTGAGCATGTGGCTGG + Intergenic
1053484796 9:38443634-38443656 AAGGGCACTGAGCATGATAAGGG + Intergenic
1054155218 9:61635096-61635118 AAGGGGCCACAGGATGAGGTGGG - Intergenic
1056027407 9:82513381-82513403 GAGGGGCGTGAGCATGAGATGGG + Intergenic
1059304059 9:113340194-113340216 GTGGGTACTGAGCCTGAGGTGGG - Intronic
1059678693 9:116565578-116565600 CAGGAGACTGAGGCTGAGGTGGG - Intronic
1059681358 9:116589819-116589841 AGGGGGACTTATCATGAGGGAGG - Intronic
1060234438 9:121852603-121852625 AAGGTGACTGAGGATGAGGAAGG + Intronic
1060392976 9:123293839-123293861 AAGGGTACAGAGGATAAGGTGGG + Intergenic
1060395100 9:123310757-123310779 CAGGGGACTGAGGCTGAGGCAGG - Intergenic
1061458883 9:130720279-130720301 AAGGGGACAGGGAATGGGGTAGG + Intronic
1061491087 9:130944600-130944622 GAGGGGAGAGAGCATGAGGTGGG + Intergenic
1061663609 9:132147384-132147406 AAAAGGACAGGGCATGAGGTTGG + Intergenic
1061826074 9:133258993-133259015 ATGGGGACAGAGCTTCAGGTTGG + Intronic
1062215120 9:135384801-135384823 ATGGGGACAGAGCATCAGTTTGG + Intergenic
1185446056 X:258521-258543 AATGGCACTGAGCATGGGGTGGG - Intergenic
1189012737 X:37062953-37062975 AATGGGACTGAGCCTTAGGCTGG - Intergenic
1189030319 X:37442783-37442805 AATGGGACTGAGCCTTAGGTTGG + Intronic
1189098710 X:38167071-38167093 GAGGGTACTTAGCATGGGGTGGG - Intronic
1189568104 X:42264846-42264868 AAGGGGACAGAATATGAAGTGGG + Intergenic
1190816422 X:53933968-53933990 CAGGGGGCAGACCATGAGGTCGG - Intergenic
1192907942 X:75571598-75571620 ATGGGGGCTGAGGAGGAGGTGGG - Intergenic
1193112771 X:77746143-77746165 AAGGTGAGAGAGCAGGAGGTGGG + Intronic
1194857858 X:98956395-98956417 AAGGGGACAGAGCACCAAGTGGG - Intergenic
1196733967 X:118968581-118968603 AGGGGAACTGAGGATGAGGTAGG + Intergenic
1197004261 X:121477069-121477091 AAGGGGATTGTGAATGGGGTTGG + Intergenic
1197733258 X:129829786-129829808 GAGGGGAGTGAACATGATGTTGG - Intronic
1197866364 X:131022943-131022965 AAGGGGACTGGGAGTGGGGTGGG - Intergenic
1198662191 X:138981765-138981787 AAGGGGACTGAGTATGAGAAGGG - Intronic