ID: 912230085

View in Genome Browser
Species Human (GRCh38)
Location 1:107783303-107783325
Sequence TAGGGAACAGAGAAGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912230074_912230085 19 Left 912230074 1:107783261-107783283 CCTTTTTAAAGCAAAGTGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 253
Right 912230085 1:107783303-107783325 TAGGGAACAGAGAAGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912230085 Original CRISPR TAGGGAACAGAGAAGGGGCC AGG Intronic
No off target data available for this crispr