ID: 912234792

View in Genome Browser
Species Human (GRCh38)
Location 1:107837970-107837992
Sequence GGGACCTGGCAAATAATTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912234787_912234792 13 Left 912234787 1:107837934-107837956 CCTAGAAGAAAACCTAGGAAATA 0: 329
1: 9573
2: 11985
3: 5037
4: 3169
Right 912234792 1:107837970-107837992 GGGACCTGGCAAATAATTCATGG 0: 1
1: 0
2: 0
3: 16
4: 172
912234785_912234792 30 Left 912234785 1:107837917-107837939 CCTCAAACTGTAAAAATCCTAGA 0: 14
1: 237
2: 1033
3: 3899
4: 18920
Right 912234792 1:107837970-107837992 GGGACCTGGCAAATAATTCATGG 0: 1
1: 0
2: 0
3: 16
4: 172
912234788_912234792 1 Left 912234788 1:107837946-107837968 CCTAGGAAATACTCTTCTCAACA 0: 17
1: 75
2: 196
3: 492
4: 1359
Right 912234792 1:107837970-107837992 GGGACCTGGCAAATAATTCATGG 0: 1
1: 0
2: 0
3: 16
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912234792 Original CRISPR GGGACCTGGCAAATAATTCA TGG Intronic
904670216 1:32159089-32159111 GTGACCTGGCAAAGGATGCATGG + Intronic
905261752 1:36723960-36723982 GGGACATGGCACAGAATACAAGG + Intergenic
905712034 1:40113382-40113404 TGGCCTTGGCAAATAATTTATGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
907270630 1:53288879-53288901 AGGGCCTGGAAAATAAATCATGG + Intronic
907596670 1:55726720-55726742 AGAACCTGGCAAAAAATTGATGG + Intergenic
909577981 1:77196876-77196898 TGGCCTTGGCAAATAATTCATGG - Intronic
910159700 1:84259845-84259867 GGCGCCTGGCAAATGCTTCATGG + Intergenic
911146398 1:94556238-94556260 GGAACCTGGCAGATGACTCAGGG + Intergenic
912234792 1:107837970-107837992 GGGACCTGGCAAATAATTCATGG + Intronic
912984195 1:114410209-114410231 GGGACCTGGAGAAGGATTCATGG + Exonic
917681289 1:177370517-177370539 AGGAACAGGCAAATATTTCATGG + Intergenic
918404832 1:184201376-184201398 GGGAAGTGTCAAATAATTTAAGG + Intergenic
1063461493 10:6217420-6217442 GGGACGTAGGAAATAATTCAGGG + Intronic
1063882764 10:10548076-10548098 GGCCCCTGGCTGATAATTCAGGG - Intergenic
1064038275 10:11934548-11934570 TGGAGCTGGCAAAGACTTCACGG - Intronic
1065071419 10:22028224-22028246 GGGACCTGGACAATAGTTCAAGG - Intergenic
1068960457 10:62861988-62862010 GAGACCTGGAAAGTAATGCAAGG - Intronic
1070467642 10:76740035-76740057 ATGATCTGGAAAATAATTCATGG - Intergenic
1072853039 10:98917038-98917060 GGGACTTGGCAACTATTACAAGG + Intronic
1074013773 10:109511438-109511460 AGGAACTGGCAAAGATTTCATGG - Intergenic
1074190662 10:111132711-111132733 CGGCCTTGGCAAATAATTTATGG - Intergenic
1078576045 11:12503562-12503584 GGGACCTGGCAAAGAACTGAGGG + Intronic
1079785446 11:24665578-24665600 GGGACCTGGTAATTGAATCATGG + Intronic
1080258721 11:30322965-30322987 GTGAAGTGGCAAATGATTCAAGG - Intergenic
1080932937 11:36832003-36832025 GGGCTTTGGCAAATAATTTAAGG - Intergenic
1085802017 11:79599473-79599495 GGGAACTGGCATATAATGTATGG - Intergenic
1088431174 11:109760612-109760634 TGGCCCTGGCAAAGAATTTATGG - Intergenic
1091014094 11:132034171-132034193 GAGACCTTGCAAATGCTTCAAGG + Intronic
1091874898 12:3925524-3925546 AGGATCTGGCAAATAATAAAAGG + Intergenic
1092679112 12:10957499-10957521 AGGACCTGGCAAAGATTTCATGG + Intronic
1092740338 12:11622529-11622551 GGTACCAGGCCAATATTTCAAGG - Intergenic
1097198660 12:57259616-57259638 AGGAACTGACAAATGATTCAAGG + Intronic
1099475326 12:83101815-83101837 GATACCTGTCAAATAATTAATGG + Intronic
1100120559 12:91364717-91364739 GGGTGCTGGCAATTAATTCCAGG - Intergenic
1101404273 12:104414214-104414236 GAGTCCTTGCATATAATTCAGGG - Intergenic
1103122452 12:118392087-118392109 GGAACTTGGCAAATACTGCAAGG + Intronic
1103964492 12:124630134-124630156 GGGAAGGGGCAAATAATTCCTGG - Intergenic
1105843272 13:24273771-24273793 GGGAACTGAAAAATAAGTCATGG + Intronic
1106099750 13:26683872-26683894 GGGACCTGGTTAAGAATCCATGG - Intronic
1106648158 13:31659359-31659381 GGGCCTTGGCAAAGAATTTATGG - Intergenic
1107151808 13:37120354-37120376 GGAAACTGGTAAATAGTTCAAGG - Intergenic
1107565183 13:41595080-41595102 AGGCCCTGTCAAAAAATTCAAGG + Intronic
1107919653 13:45191010-45191032 GAGACTTTTCAAATAATTCAAGG - Intronic
1110439128 13:75507942-75507964 GGGACCAGGCTACTAGTTCAGGG - Intergenic
1110875617 13:80506117-80506139 TGGCCTTGGCAAATAATTTATGG - Intergenic
1110994811 13:82093785-82093807 AGGACCTTGCAAAAATTTCATGG + Intergenic
1111328924 13:86736848-86736870 TGGGCTTGGCAAACAATTCATGG + Intergenic
1111846813 13:93520364-93520386 GTCACCTGGCAAAGAATTTAAGG - Intronic
1114785743 14:25596555-25596577 TGGACCAGGGAAATAAGTCAGGG - Intergenic
1114881361 14:26790052-26790074 GGCACCTGAGACATAATTCAAGG - Intergenic
1120275164 14:82363963-82363985 GGGAAGTGGCCAAAAATTCAGGG + Intergenic
1121529293 14:94641187-94641209 GGCACCCCGCAAATACTTCAAGG - Intergenic
1122159066 14:99769585-99769607 GAGACCTGACAACTAGTTCAGGG + Intronic
1124635602 15:31362921-31362943 GGGGCCTGTCAAATAAATTATGG - Intronic
1125761224 15:42096989-42097011 AGGTCTTGGCACATAATTCATGG - Intergenic
1126363008 15:47865414-47865436 GGGCCCATTCAAATAATTCATGG - Intergenic
1127324489 15:57882148-57882170 AGGGCCTGGAAACTAATTCATGG - Intergenic
1129163364 15:73760380-73760402 GGGGCATGGCACATAACTCAGGG + Intergenic
1130001763 15:80054012-80054034 GGGAGCTTGCAAAGAATTGATGG - Intergenic
1130932581 15:88440264-88440286 AGGAACTAGCACATAATTCAAGG - Intergenic
1131637336 15:94250152-94250174 GTCACCTGGAAAATAATTTATGG - Intronic
1133664851 16:7956556-7956578 TGGTCTTGGCAATTAATTCATGG - Intergenic
1134201240 16:12200945-12200967 GGTACCTGGCATATAATAAATGG + Intronic
1137069655 16:35891987-35892009 TGGCCCTGGCAAATAATTTATGG + Intergenic
1140453544 16:75090732-75090754 GGGACCAGGCAGAAAATTCAGGG - Intronic
1146622502 17:34409989-34410011 AGGAACTGGCAAAGATTTCATGG + Intergenic
1147230983 17:39017674-39017696 GGGCCTTGGAAAATCATTCAGGG + Intergenic
1148127878 17:45246137-45246159 GGGACCAGGCAGATATTCCAGGG + Intronic
1148201202 17:45751123-45751145 GGGACAAGGCAAATTATTCCAGG + Intergenic
1151020088 17:70604968-70604990 GGGACCTTGCAAAGTATTCAAGG - Intergenic
1155269243 18:24123324-24123346 GGAACCTGGGAAATAGTTGAAGG + Intronic
1157989891 18:52482313-52482335 GGGAACTGGCAAATAATTTGGGG - Intronic
1158036715 18:53040733-53040755 GGGATCTGGCAAACTAATCAAGG + Intronic
1161858547 19:6780166-6780188 AGGAGCTGGAAAATGATTCATGG - Intronic
1162899375 19:13785437-13785459 AGAACCTGGCAAAGAACTCAAGG - Intergenic
926183962 2:10673164-10673186 GCAACCTGGCAAATAAATCTAGG + Intronic
926964378 2:18393891-18393913 AGGACCTAGCAAAGATTTCATGG + Intergenic
927194516 2:20538530-20538552 GGGGCCTGGGAGATATTTCAGGG - Intergenic
928761001 2:34582862-34582884 TGGCCCAGGCAAATAATTTATGG + Intergenic
929163972 2:38862101-38862123 GGGAGTTGGGAAAGAATTCAAGG - Intronic
929643829 2:43607933-43607955 GGGACCTGGACAGTAATTTATGG - Intergenic
930673869 2:54179407-54179429 GGGTTCTTGGAAATAATTCAGGG + Intronic
931925664 2:67069548-67069570 AGGAACTGGCAAAGATTTCATGG + Intergenic
933366733 2:81362758-81362780 GGGACCTGCCGAACAAGTCACGG + Intergenic
935094252 2:99928828-99928850 GGGACCTGTCAAATTAGTCCAGG + Intronic
937294583 2:120802112-120802134 GTGACTTTGCAAATAACTCACGG - Intronic
937813836 2:126229200-126229222 GGGACCAGGACAATAATGCAGGG - Intergenic
937831556 2:126430024-126430046 GGGAAGTGGCAAACTATTCAAGG + Intergenic
939040719 2:137186289-137186311 GGGCTTTGGCAAATAATTTATGG - Intronic
940615440 2:156043570-156043592 AGGAACTGGCAAAGATTTCATGG + Intergenic
944595599 2:201257949-201257971 GGGATGTGGCAGACAATTCATGG - Intronic
944928912 2:204495874-204495896 GGGACAAGGCAAATCATTGAGGG - Intergenic
945487399 2:210413195-210413217 TGGCCCTGGCAAAGATTTCATGG - Intergenic
946663182 2:222022480-222022502 TGGCCTTGGCAAATAATTTATGG + Intergenic
1169896587 20:10510903-10510925 GGTGCCTGGCAAATTATTAATGG + Intronic
1170182164 20:13543995-13544017 GGGACCAGCCAAATATTTCACGG - Intronic
1170223203 20:13963346-13963368 GGAAACTGCCAAATATTTCAAGG - Intronic
1170418617 20:16170533-16170555 GGCACCTGGCCAATAACACACGG - Intergenic
1175762590 20:61571596-61571618 GGGAGCTGGCATAGAATGCAGGG - Intronic
1176995686 21:15552738-15552760 GCCAGCTGGCAAATAAATCAGGG + Intergenic
1177934267 21:27322760-27322782 GGGTTCTGGCAAATATTTTAGGG + Intergenic
950453886 3:13081000-13081022 GGGAGCTGGCTAAAAATGCAAGG + Intergenic
952768472 3:36976194-36976216 CGGCCCAGTCAAATAATTCAAGG + Intergenic
957244415 3:77700031-77700053 TTGAAATGGCAAATAATTCAAGG + Intergenic
958690627 3:97461105-97461127 GGCAACTGGCAAAAACTTCAGGG + Intronic
959822001 3:110746528-110746550 GGGAACTGGCAAAGATTTCATGG + Intergenic
962280530 3:134048690-134048712 GGGACCTGGGGAGAAATTCACGG - Intronic
962408265 3:135118625-135118647 GTGACCTGGCACAAAATTAATGG + Intronic
965295428 3:166939459-166939481 AGGCCCTGGCAAAGATTTCATGG - Intergenic
967443578 3:189538089-189538111 TGGCCTTGGCAAATAATTTATGG - Intergenic
967611937 3:191516942-191516964 TGGACATGACAAATAATTCTTGG + Intergenic
968569137 4:1330199-1330221 GGGACCTGGCCTGTACTTCATGG + Intronic
970114346 4:12677044-12677066 GGGTCCTGGAAACTCATTCAGGG + Intergenic
971742772 4:30541120-30541142 GAAACCTGAAAAATAATTCATGG + Intergenic
977744741 4:100532912-100532934 GGGACCTAGCAATGTATTCATGG + Intronic
979339928 4:119510275-119510297 GAGCCCTGGAAAAAAATTCAGGG - Intronic
979931557 4:126638570-126638592 GGGTCCTGGCAGAGACTTCAAGG + Intergenic
981595117 4:146411631-146411653 GGCACTTGAAAAATAATTCATGG + Intronic
982342668 4:154319279-154319301 GGGTCTTGGCAATTATTTCATGG + Intronic
982578813 4:157152593-157152615 GGGACCTGACAAATTGTTCATGG + Intronic
985093531 4:186389045-186389067 CGGCCTTGGCAAATAATTTATGG + Intergenic
985225409 4:187754997-187755019 CGGCCTTGGCAAATAATTTATGG - Intergenic
985623598 5:970602-970624 GTGACCTTCTAAATAATTCAAGG + Intergenic
987938481 5:24501287-24501309 GGGTCTTTACAAATAATTCAAGG + Intronic
990031671 5:51268030-51268052 GGGACCTGAAAAAAAATGCAAGG + Intergenic
990311753 5:54546976-54546998 GGGACCTGGCATATCTTGCAAGG + Intergenic
995477975 5:112566841-112566863 GGAACCTGGCAAATCCTACATGG + Intergenic
995664006 5:114520382-114520404 GGGAACTGCCAAATAATTTCAGG + Intergenic
995668394 5:114571093-114571115 TGGGCTAGGCAAATAATTCATGG - Intergenic
996888814 5:128392720-128392742 TGGTTCTGGAAAATAATTCAAGG + Intronic
998265224 5:140663047-140663069 GGGCCTTGGCAAATGTTTCAGGG - Intergenic
999806632 5:155087377-155087399 GAGACCTGGCAATTCATTTAGGG - Intergenic
1004911027 6:20284106-20284128 TGGCCTTGGCAAATAATTTATGG + Intergenic
1005331380 6:24753845-24753867 GGGATCTGGTAAATAAATTATGG + Intergenic
1006217447 6:32456951-32456973 AGGACTTGGCAAAGATTTCATGG + Intergenic
1006809654 6:36811619-36811641 GGGACCTGGCCTAGAACTCAGGG + Intronic
1008315534 6:50035279-50035301 TGGCCCTGGCAAATAATTTTTGG + Intergenic
1009887177 6:69637974-69637996 GAGACCTGGACATTAATTCATGG + Intergenic
1010354439 6:74915025-74915047 GGGAGCTGGAAAATAAATCAGGG - Intergenic
1010647070 6:78402246-78402268 AGGCCCTGGCAAAGATTTCATGG - Intergenic
1011586294 6:88929226-88929248 TGGACCTGACAAATACTTCAAGG - Exonic
1015293219 6:131561611-131561633 GGGAAATGGCAAATGATTGAGGG - Intergenic
1015304134 6:131687445-131687467 GGGTCTTGGCAAATAATTTTTGG + Intronic
1016223875 6:141709716-141709738 GGGTCTTGGCAAATAATTTTTGG + Intergenic
1017008808 6:150048374-150048396 GGGACATGTCAAATCTTTCATGG + Intergenic
1021488653 7:21194230-21194252 GGGACATTGAAAAAAATTCAGGG + Intergenic
1022627818 7:32056163-32056185 GGGACCTGGCAAATTTGGCAGGG + Intronic
1024429485 7:49269772-49269794 AGGACATGACAAATAATTTAAGG - Intergenic
1024681613 7:51695687-51695709 GGGAGATGGCTATTAATTCATGG - Intergenic
1027694121 7:81387518-81387540 GGAACCAGGAAAATAAATCATGG - Intergenic
1028390242 7:90307790-90307812 GAGAGCTGGCTAATAAATCATGG + Exonic
1029698052 7:102227584-102227606 GGGACATGGCTACTAATTCTTGG - Exonic
1029878638 7:103781261-103781283 TAGAGCTGTCAAATAATTCATGG + Intronic
1030397491 7:109005596-109005618 GGGAACTGGCAAATAAAAGAGGG + Intergenic
1030675337 7:112379235-112379257 GGGCCCACTCAAATAATTCAGGG + Intergenic
1031008552 7:116500096-116500118 GGAACCTGGCTAAGAATTCCTGG - Intronic
1033522759 7:142178415-142178437 TGGCCTTAGCAAATAATTCATGG - Intronic
1033770964 7:144551089-144551111 GGAACCTGTGAAATGATTCATGG - Intronic
1034586865 7:152101584-152101606 GTGCCCTGGGAAAGAATTCAGGG + Intronic
1035528743 8:335032-335054 GGGACCTGGCCGAGAGTTCAGGG + Intergenic
1038736237 8:30172213-30172235 GGGACCTGTGAAATAAATTATGG + Intronic
1038960703 8:32515971-32515993 TGGCCTTGGCAAATAATTTATGG - Intronic
1043967946 8:86500114-86500136 AGGCCCTGGCAAAGATTTCATGG + Intronic
1045234903 8:100342955-100342977 GGGACCAGGGAAAGAAGTCAAGG + Intronic
1046236759 8:111434313-111434335 TGGCCCTGGCAAAGAATTCTTGG - Intergenic
1046376278 8:113385472-113385494 GAGACCTGGCACACCATTCAAGG - Intronic
1048617236 8:136090478-136090500 GGAAGCAGGGAAATAATTCAAGG + Intergenic
1048901264 8:139040007-139040029 GGGGCCTGGCAAATGATAAAAGG - Intergenic
1051239717 9:15040624-15040646 GGTACCTGGAAAAAAATTGAAGG + Intergenic
1051406975 9:16748216-16748238 AGGATCTGGCAAATAAGTCTGGG + Intronic
1051573515 9:18587032-18587054 AGGAACTGGCAAATATTTCGTGG + Intronic
1053752241 9:41268424-41268446 CGGCCTTGGCAAATAATTTATGG - Intergenic
1054257767 9:62832756-62832778 CGGCCTTGGCAAATAATTTATGG - Intergenic
1054333552 9:63782967-63782989 CGGCCTTGGCAAATAATTTATGG + Intergenic
1056983722 9:91341656-91341678 GGCACTTAGCAAATAGTTCATGG - Intronic
1059807490 9:117818628-117818650 AGGCCTTGGCAAATAATTTATGG - Intergenic
1059976617 9:119724669-119724691 GGCATCTGGCATATAATTCTGGG - Intergenic
1185946761 X:4385391-4385413 TGGCCCTGGCAAATTATTCAGGG - Intergenic
1188123845 X:26343420-26343442 AGGTCCTGGCAAAGATTTCATGG - Intergenic
1188798127 X:34491699-34491721 AAGACCTGGCAAATACTTCATGG - Intergenic
1188984840 X:36759859-36759881 AGAACATGGCAGATAATTCATGG - Intergenic
1191172675 X:57464474-57464496 GGGTTTTGGCAAATAATTTATGG + Intronic
1192564839 X:72155022-72155044 GGGACCTGACAGATAATATAAGG - Intergenic
1192564918 X:72155577-72155599 GGGACCTGACAGATAATATAAGG - Intergenic
1194367614 X:93028935-93028957 GGGCCTTGGCAAATAATTTTTGG + Intergenic
1197744840 X:129925158-129925180 GGGAACTGCCAAAGACTTCACGG - Exonic
1199823735 X:151476795-151476817 GGAATCTCCCAAATAATTCAAGG - Intergenic
1200675821 Y:6145194-6145216 GGGCCTTGGCAAATAATTTTTGG + Intergenic