ID: 912241198

View in Genome Browser
Species Human (GRCh38)
Location 1:107911115-107911137
Sequence ATGTGCTATTAGAAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912241198 Original CRISPR ATGTGCTATTAGAAGTTGGG AGG (reversed) Intronic
901620970 1:10586977-10586999 CTGTGGTATTAGAAGTTAGGTGG + Intronic
911820669 1:102415809-102415831 ATATGCCATTAGAAGTGAGGTGG - Intergenic
912172571 1:107118327-107118349 ATGGGACACTAGAAGTTGGGAGG - Intergenic
912241198 1:107911115-107911137 ATGTGCTATTAGAAGTTGGGAGG - Intronic
915739176 1:158105362-158105384 ATGTGCTATTTTATGTTGGATGG + Intergenic
917716254 1:177740959-177740981 ATGTGTTATTGGAACTTGGCTGG - Intergenic
918003983 1:180524739-180524761 ATGTGGAATCAGAAGTAGGGAGG + Intergenic
918187374 1:182140343-182140365 CTGTACTAAAAGAAGTTGGGAGG - Intergenic
918718943 1:187827732-187827754 ATGTGCTCTGAGAACTTGGATGG + Intergenic
921436286 1:215127131-215127153 AAATGACATTAGAAGTTGGGAGG + Intronic
1067783191 10:49223811-49223833 ATATGCTATTAGAAGTAGCCAGG + Intergenic
1068816765 10:61324529-61324551 ATTTGCTATTAAAACTTTGGAGG - Intergenic
1068852742 10:61762800-61762822 TTGTGATATTAGAAGTTATGTGG - Intronic
1069303485 10:66938325-66938347 ATATGCTATTAGTAGTTCTGGGG - Intronic
1074242408 10:111652147-111652169 ATGTGTTATTTGGAGTTTGGGGG - Intergenic
1074381684 10:112985791-112985813 AAATGCTGGTAGAAGTTGGGAGG + Intronic
1077360022 11:2136783-2136805 GTGTGCTCTTAGAATTTGGAAGG - Intronic
1083704169 11:64501794-64501816 AAGTGCAATTACAAGTGGGGCGG - Intergenic
1086074232 11:82833278-82833300 AGGTGCTAGTAGAAGTAAGGGGG + Intronic
1090088431 11:123672101-123672123 ATGTGCAAACAGAAATTGGGGGG - Intergenic
1090418733 11:126558728-126558750 ATGTGCTTTGAGAAGGTGAGTGG + Intronic
1095163869 12:38948639-38948661 ATTTGCTCTTACAAGTTGGCAGG + Intergenic
1095705870 12:45236383-45236405 AGGGCCTATTAGAAGGTGGGGGG - Intronic
1096452226 12:51753270-51753292 ATGTACAATTAGCAGTGGGGAGG + Intronic
1097174877 12:57136687-57136709 ATGTGGTGATAGAGGTTGGGAGG + Intronic
1097738132 12:63206022-63206044 AAGTGCTACTGGAGGTTGGGTGG + Intergenic
1097752853 12:63377443-63377465 ATGTGCTATCAAAAGTTTGCAGG + Intergenic
1097788066 12:63783108-63783130 ATGTGTTATTAGAAACTGGAAGG - Intronic
1102547525 12:113667443-113667465 ATGGGATATTTGAGGTTGGGGGG - Intergenic
1103430361 12:120879550-120879572 ATGAGCTATGAGAAGTTGGGCGG - Intronic
1107154379 13:37149426-37149448 ATATGCTATTAGAAGTTGATTGG - Intergenic
1107517363 13:41143848-41143870 ATCTGGTATTAATAGTTGGGAGG - Intergenic
1107607759 13:42078589-42078611 ATGTGCTCTGAGGGGTTGGGCGG + Intronic
1108737892 13:53304892-53304914 ATCTGCAATTGGAAGTTGGATGG + Intergenic
1109756480 13:66767564-66767586 ATGTACTTTTAGAAGTTTGAAGG - Intronic
1112378587 13:98866466-98866488 AGGTGCCATTAGCAGTTTGGTGG + Intronic
1115456595 14:33611272-33611294 AAGTACTATTAAAAGTAGGGTGG + Intronic
1119750286 14:77072478-77072500 ATGTGCAATTTGACCTTGGGAGG + Intergenic
1126379380 15:48030148-48030170 AAGGGCTATTAGAATTAGGGAGG - Intergenic
1127442169 15:59020729-59020751 ATCTGGTATTAGAATTTAGGGGG + Intronic
1128624322 15:69183836-69183858 CTGTGGTATGAGGAGTTGGGAGG + Intronic
1131518462 15:93095329-93095351 TTTTGCTATCAGAAGTTGTGGGG + Intergenic
1132187495 15:99814400-99814422 GTTTGCTATTATAAATTGGGGGG - Intergenic
1132888725 16:2194140-2194162 GTGGGCTATTAGAAGGTGAGAGG + Intronic
1135951745 16:26920667-26920689 AGGTGCTATTTTATGTTGGGTGG - Intergenic
1146769337 17:35554217-35554239 ATATGTTATGAGAAGTTGGAAGG + Intronic
1147928667 17:43962211-43962233 ATGTGCTATTAGAAGGAATGGGG + Intronic
1148614729 17:48992296-48992318 ATGTATTAATAGAGGTTGGGTGG + Intergenic
1149014161 17:51888991-51889013 AGTTGCTCTTAGAAGTTGGCCGG + Intronic
1149397288 17:56257884-56257906 ACGTGCTCTTAGAAGGTGGAGGG - Intronic
1153204788 18:2686728-2686750 ATGTGATTGTAGATGTTGGGAGG + Intronic
1159480918 18:68990166-68990188 ATGTGCCACTAGGAGTTTGGGGG - Intronic
1159859154 18:73626535-73626557 ATATGCTAGTAAAACTTGGGTGG + Intergenic
1161732967 19:5973436-5973458 ATGTGCTATTAGCATTTAGTGGG + Intronic
925358902 2:3263487-3263509 ATGTGCTATTTGTAGTGGTGGGG - Intronic
929732633 2:44511906-44511928 CAGTACTATTAGAAGATGGGGGG - Intronic
929916123 2:46137297-46137319 ATGTGATCTGAGATGTTGGGTGG - Intronic
930973884 2:57430773-57430795 GTGTGCTAGCAGATGTTGGGAGG - Intergenic
931135229 2:59391918-59391940 ATGTGCATTTTGAAGTTGCGAGG - Intergenic
932895017 2:75631103-75631125 ATGTGGTATGAGCAGCTGGGTGG + Intergenic
936814720 2:116445531-116445553 ATGTGCTATTAGAAGCAGACAGG + Intergenic
939406261 2:141761556-141761578 ATGTGCTATTAGAAATTTAGAGG + Intronic
939722469 2:145671557-145671579 ATGTGCTACTCCAAGGTGGGTGG + Intergenic
940099617 2:150019324-150019346 CTCTGCTACTACAAGTTGGGCGG - Intergenic
941317147 2:164007636-164007658 ATGAGCTCTTAGAACTTGGTGGG + Intergenic
941621549 2:167784577-167784599 ATGTGCTATTACAAATAGAGTGG - Intergenic
942291797 2:174480200-174480222 AGGTGCTATTTGAGGTAGGGTGG - Intronic
944444249 2:199773763-199773785 ATGTCATAATAGTAGTTGGGGGG - Intronic
944604556 2:201339993-201340015 AATGGCTATGAGAAGTTGGGTGG + Intronic
945424553 2:209684168-209684190 CTGAGCTATTAGAATTTGGAAGG + Intronic
1170062709 20:12276212-12276234 TTGTGCTACCTGAAGTTGGGGGG - Intergenic
1173608498 20:44349422-44349444 AGGTGCTCTCAGAAGTTTGGGGG - Intronic
1175225630 20:57442343-57442365 TTGTGCTAATAGGGGTTGGGAGG - Intergenic
1175678107 20:60964650-60964672 TTGTGCAATGAGAGGTTGGGGGG + Intergenic
949285104 3:2393413-2393435 ATATGCTATTAAAAGGTGGAAGG - Intronic
952760407 3:36908560-36908582 ATGTGCCCTTTGAAGGTGGGTGG - Intronic
952833686 3:37586628-37586650 TTGTGCTATGAGAATTTTGGGGG + Intronic
957005627 3:74943253-74943275 ATGTGCTATTATAATCTGGCTGG - Intergenic
959200372 3:103238503-103238525 TTGTGCTATTAGAGATAGGGTGG - Intergenic
965137456 3:164789553-164789575 ATCTGCTAAAAGTAGTTGGGTGG + Intergenic
967635818 3:191801679-191801701 CTGTGGCAGTAGAAGTTGGGTGG - Intergenic
967849779 3:194072928-194072950 ATGTGCTATGAGGAGGTGAGAGG - Intergenic
968684463 4:1947960-1947982 ACGTGCTTTTAGCAGTTGGCTGG + Intronic
970988535 4:22186690-22186712 ATGTTTTATTAAAAGGTGGGGGG + Intergenic
971268965 4:25119653-25119675 TTGTGCTATTTGAAGTTTGCAGG - Intergenic
972413108 4:38812628-38812650 ATGTGATAATATCAGTTGGGAGG + Intronic
973095609 4:46195512-46195534 ATGTGGTCTTAGAAGCTGAGAGG + Intergenic
973166948 4:47089776-47089798 TTATGCTATTAAAATTTGGGAGG + Intronic
974663504 4:64925871-64925893 TCGTGGTATTAGAATTTGGGAGG + Intergenic
975423495 4:74197519-74197541 ATGTCTTATTAGGAGTTGGGAGG + Intronic
976516268 4:85970696-85970718 GTGTGCTCTGAGAAGTTGGGAGG - Intronic
977082342 4:92547753-92547775 ATTTGATATTATAAGTAGGGAGG + Intronic
978455251 4:108882123-108882145 TTGAGCTTTTTGAAGTTGGGAGG - Intronic
979417085 4:120455216-120455238 AAGAGCTAGAAGAAGTTGGGTGG - Intergenic
979625610 4:122841736-122841758 CTTTGCTGTTAAAAGTTGGGTGG - Intronic
979791669 4:124790541-124790563 ATGTGGTTTTAGAGGGTGGGAGG + Intergenic
980631026 4:135433824-135433846 TTGTGCTTTCAGAAGTTGGGTGG - Intergenic
986727698 5:10611680-10611702 ATGTGTTGTTAGAAGTTTGGAGG - Intronic
989126621 5:38059814-38059836 ATGTGAAACAAGAAGTTGGGGGG - Intergenic
989238658 5:39178800-39178822 ATGTGTTAAAAGATGTTGGGGGG - Intronic
989304658 5:39939521-39939543 ATGTGCTCTGAGGACTTGGGAGG - Intergenic
991251372 5:64565612-64565634 ATGTGGTGTGAGAAGTTGGAAGG - Intronic
992648051 5:78830617-78830639 ATGTGCTGTGTGAAGTGGGGTGG + Intronic
995283752 5:110363629-110363651 CAGTGCTGTTAAAAGTTGGGAGG + Intronic
996149356 5:120016558-120016580 CTCTTCTGTTAGAAGTTGGGGGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
1008038477 6:46772518-46772540 ATGTGATTTTATAAGATGGGGGG - Intergenic
1008398721 6:51038909-51038931 ATATGGTATTAGAGGTTGGAAGG + Intergenic
1008660382 6:53661615-53661637 ATGGGCTAATAGAAGATGGCTGG + Intronic
1010056823 6:71576065-71576087 AGCTGTAATTAGAAGTTGGGTGG - Intergenic
1011749567 6:90441294-90441316 TTGTGCGATTAAAATTTGGGAGG + Intergenic
1012744013 6:103059588-103059610 ATGGCCTATTTGAGGTTGGGAGG + Intergenic
1014574343 6:123052129-123052151 ATGATATATTAGAAGTTGGGAGG + Intronic
1014945779 6:127495568-127495590 ATGTGCCATTACAAGATGGCAGG + Intronic
1016850279 6:148612242-148612264 CTGAACTTTTAGAAGTTGGGAGG - Intergenic
1018721342 6:166575160-166575182 ATGTGCTCTGAGAAGTTGTATGG - Intronic
1019311851 7:366145-366167 CTGTGCTATGAGAGGCTGGGAGG - Intergenic
1021310678 7:19092206-19092228 ATGTGTAATTAAAAGCTGGGTGG - Intronic
1023260318 7:38351941-38351963 ATGTAACATTAGAAATTGGGCGG - Intergenic
1023260828 7:38356771-38356793 ATGTAACATTAGAAATTGGGGGG - Intergenic
1023261809 7:38365895-38365917 ATGTAACATTAGAAATTGGGGGG - Intergenic
1027729411 7:81851109-81851131 ATGAGCTTATGGAAGTTGGGTGG - Intergenic
1028769116 7:94595583-94595605 ATGTGATATTATATTTTGGGAGG - Intronic
1030070893 7:105696591-105696613 ATGTGATATTACAAGTTCAGTGG - Intronic
1031819992 7:126488558-126488580 ATGTGAAATTAGAAGATGAGAGG - Intronic
1032845707 7:135749703-135749725 ATCTGCTATAAGAAGTTGTTTGG + Intergenic
1038463610 8:27739138-27739160 ATGTGCTAATTGAGGTGGGGGGG - Intronic
1040628680 8:49182548-49182570 ATGTGCAATTAGAAACTAGGGGG - Intergenic
1040633032 8:49238531-49238553 ATGTGCTGCTAGAAGCTTGGTGG - Intergenic
1042337775 8:67646669-67646691 ATGTGCTAATTCAAATTGGGTGG + Intronic
1043195935 8:77291311-77291333 AGGTGCTACTAGAATTTGGTGGG + Intergenic
1044737363 8:95292913-95292935 AAATGTTATTAGAAGTGGGGTGG - Intergenic
1047095442 8:121620012-121620034 CTTTGCTATTGGAAATTGGGAGG - Intronic
1050697839 9:8298837-8298859 ATGTACCAGTAGAAGTTGGTTGG - Intergenic
1051864585 9:21665139-21665161 ATGTTCTCATAGGAGTTGGGAGG + Intergenic
1053783093 9:41630952-41630974 TTGTGCTACAAGAAGTCGGGGGG - Intergenic
1056645479 9:88408267-88408289 ATGGGCTCTCAGAAGGTGGGGGG - Intronic
1057451505 9:95165854-95165876 ATATGTTATTAAAAGTGGGGTGG + Intronic
1057980745 9:99660207-99660229 CAGTGCTAATAGAAATTGGGGGG - Intergenic
1058261966 9:102845039-102845061 ATGTGGTATCAGAAGAGGGGAGG + Intergenic
1186329820 X:8519792-8519814 ATGTCCTATTGGGGGTTGGGGGG + Intergenic
1186752113 X:12631975-12631997 ATGTGAAATTAGAGGTTGGTGGG - Intronic
1189226544 X:39418151-39418173 AAGTGATATTGGATGTTGGGGGG + Intergenic
1189715682 X:43862964-43862986 ATGTGGTATTCTAACTTGGGAGG - Intronic
1193283389 X:79683153-79683175 ATGTGCTAAAAAAAGATGGGAGG - Intergenic
1193499280 X:82254100-82254122 ATGTCCTACTTGAAGTTGGAGGG - Intergenic
1195472798 X:105251558-105251580 ATATGGCATTAGAAGTGGGGAGG + Intronic
1196758989 X:119182723-119182745 ATGTGGTATTAGCAGGGGGGTGG + Intergenic
1197593238 X:128435113-128435135 ATGTGCAATTAGACTATGGGAGG + Intergenic