ID: 912243818

View in Genome Browser
Species Human (GRCh38)
Location 1:107939936-107939958
Sequence AAGAACTTCATGGGTACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912243818_912243823 12 Left 912243818 1:107939936-107939958 CCAGATGTACCCATGAAGTTCTT 0: 1
1: 0
2: 2
3: 7
4: 115
Right 912243823 1:107939971-107939993 GGAACTGTCTACTGCAGCTGTGG 0: 1
1: 1
2: 3
3: 37
4: 324
912243818_912243824 25 Left 912243818 1:107939936-107939958 CCAGATGTACCCATGAAGTTCTT 0: 1
1: 0
2: 2
3: 7
4: 115
Right 912243824 1:107939984-107940006 GCAGCTGTGGTTGCAATAAGAGG 0: 1
1: 0
2: 1
3: 15
4: 192
912243818_912243822 -9 Left 912243818 1:107939936-107939958 CCAGATGTACCCATGAAGTTCTT 0: 1
1: 0
2: 2
3: 7
4: 115
Right 912243822 1:107939950-107939972 GAAGTTCTTGGAAGCTTGTATGG 0: 1
1: 0
2: 1
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912243818 Original CRISPR AAGAACTTCATGGGTACATC TGG (reversed) Intronic
901710119 1:11107454-11107476 AAAAACGTGATGGGCACATCTGG + Exonic
905718527 1:40175228-40175250 TAGAACTTTATGGGAACGTCTGG - Intronic
906657344 1:47558279-47558301 AAGGATTTCATAGGTACAGCTGG - Intergenic
908364473 1:63404520-63404542 AAGCTCTTCATGCGTACAACAGG + Exonic
909866624 1:80681317-80681339 AAGAAGTTCATGGGCACTTTTGG - Intergenic
911564959 1:99453321-99453343 AAGAACTTCATGGGTATAGCAGG - Intergenic
912243818 1:107939936-107939958 AAGAACTTCATGGGTACATCTGG - Intronic
912510248 1:110184862-110184884 ACTGACATCATGGGTACATCTGG + Intronic
913678403 1:121164689-121164711 AAGAACTACATGGGTTCTTAGGG + Intergenic
914030241 1:143952327-143952349 AAGAACTACATGGGTTCTTAGGG + Intronic
914159209 1:145115624-145115646 AAGAACTACATGGGTTCTTAGGG - Intergenic
917740867 1:177960900-177960922 TAGAACTTCATGGGTGCTTTGGG + Exonic
920465708 1:206183213-206183235 AAGAACTACATGGGTTCTTAGGG + Intergenic
920590862 1:207217215-207217237 CATAACTTCCTTGGTACATCAGG + Intergenic
1069578973 10:69552232-69552254 AAGAACTTCATGGGTGCAGCAGG + Intergenic
1071535333 10:86424186-86424208 ATTAACTTGCTGGGTACATCAGG + Intergenic
1071668820 10:87587858-87587880 AAGAAGTTACTGGGGACATCGGG + Intergenic
1073333629 10:102688067-102688089 AATAACTTTATTGGTCCATCTGG + Intronic
1073462334 10:103673108-103673130 AAGGACTTCATAGGAACAACTGG + Intronic
1075404360 10:122184504-122184526 AAGAACTTGCTGAGCACATCTGG + Intronic
1080613187 11:33922968-33922990 AAGTGCTTCATGGCTACATGTGG - Intergenic
1081332607 11:41823155-41823177 AAGAACTTTATGATTAAATCAGG - Intergenic
1082888755 11:58115869-58115891 GAGAACTTCATAGGAACTTCTGG - Intronic
1088015750 11:105057453-105057475 AAGTACTTAATAGGTACATGTGG + Intronic
1088662622 11:112062879-112062901 CAGAACTTCAAGGTTTCATCAGG - Exonic
1089172155 11:116519859-116519881 CAGAACTTCATGCAAACATCTGG + Intergenic
1090144257 11:124302960-124302982 AAGGAGTTCATGAGTAAATCAGG - Intergenic
1099547134 12:83998310-83998332 AAGAAATTCGTGTGTAAATCTGG - Intergenic
1101140551 12:101791318-101791340 CAGGAGTTCATGTGTACATCTGG + Intronic
1101696077 12:107128288-107128310 AAGATCTTCATGGTTGCATTTGG + Intergenic
1101849593 12:108391634-108391656 AGGGTCTTCATGGGGACATCGGG + Intergenic
1102363632 12:112311859-112311881 GAGAACTTCTTGGGTACTGCAGG + Intronic
1106160846 13:27200109-27200131 AGGAACTTCATCAGTATATCAGG - Intergenic
1111467169 13:88629323-88629345 AAGTGCTTCATTGGTACATTTGG - Intergenic
1111600163 13:90462558-90462580 ACGCACTTCTTGGGAACATCAGG - Intergenic
1117429245 14:55636480-55636502 AAGAAGTTCAGAGCTACATCAGG + Exonic
1118945363 14:70381208-70381230 AAGAAAGACATTGGTACATCAGG + Intronic
1120142914 14:80948333-80948355 AAGAACTTCATGGGATCAGCAGG - Intronic
1120486303 14:85117710-85117732 AAGAATTTCAGGGGTAAATTTGG - Intergenic
1120660741 14:87248086-87248108 AAGAAGTTGATGTGTACATGAGG + Intergenic
1125134146 15:36322317-36322339 AAGACCTTTCTGGGTACCTCTGG - Intergenic
1126422366 15:48488103-48488125 AAGAACTGCATGGGTAAGTTTGG - Exonic
1128893872 15:71355483-71355505 AACAACTTCCTGGGTAGATAGGG - Intronic
1129609437 15:77041352-77041374 AACATTTTCATGGATACATCTGG - Intergenic
1131886003 15:96913589-96913611 AACAACCTATTGGGTACATCAGG - Intergenic
1132371091 15:101299659-101299681 AAGAACTTTATTGGGACAACTGG + Intronic
1135894450 16:26386213-26386235 AAAAACTGCATGCATACATCAGG - Intergenic
1138896642 16:61213589-61213611 AAGAATTTCAAGGCTTCATCTGG + Intergenic
1143245371 17:5480479-5480501 AAGAAGTTCATGCGGACATAGGG + Exonic
1150127399 17:62646949-62646971 AAGCAATTCTGGGGTACATCAGG - Intronic
1150172156 17:63009424-63009446 AATAACTTAAAGGGTACAACTGG - Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1161110940 19:2469696-2469718 AATCACTTCCTGGCTACATCCGG + Intergenic
1166262532 19:41650921-41650943 AGAAACTTCATGGTTACAGCAGG - Intronic
1167082472 19:47286410-47286432 ACTCACTTCATGGGTACATTTGG - Intergenic
932500061 2:72175332-72175354 AAGAACCTCCTAGGCACATCTGG - Intergenic
940204988 2:151192869-151192891 AGGAACTTCATGGGTCAGTCTGG - Intergenic
942476720 2:176334154-176334176 AACCACTTCAGGGGTACTTCTGG + Intronic
945807171 2:214503906-214503928 AAGAATTTCAAGGGAATATCAGG - Intronic
946143257 2:217709777-217709799 CAGAACACCATGGGTACAGCAGG - Intronic
947853879 2:233310115-233310137 AGGAAGTTCATGGGCACACCTGG - Intronic
1169422381 20:5471008-5471030 AAGAACTCGATGGGTACCTGAGG + Intergenic
1171749340 20:29032760-29032782 AAGAGCTTCATTGGTACACTTGG - Intergenic
1180393635 22:12308873-12308895 AAGAGCTTCATTGGTACACTCGG + Intergenic
1180406114 22:12555879-12555901 AAGAGCTTCATTGGTACACTCGG - Intergenic
1181448017 22:22993515-22993537 AAGACCTCATTGGGTACATCAGG + Intergenic
1181742515 22:24932738-24932760 AAGAACTTCATCTGAACATCTGG - Intergenic
1184171619 22:42763386-42763408 ACGTACTTCAGGGGTGCATCAGG + Intergenic
951154009 3:19326935-19326957 AAGGACTTCATTGATATATCTGG + Intronic
952696779 3:36274315-36274337 AAGATGTGCATGTGTACATCAGG - Intergenic
953617976 3:44509036-44509058 AAGAAATTCTTGGTTACACCAGG - Intronic
955775541 3:62428579-62428601 AAGAAGTCCATGTGTCCATCTGG - Intronic
958873339 3:99587903-99587925 AAGAACTTGCTGTGTACATGTGG - Intergenic
962504955 3:136037259-136037281 AAGAACTTAATGCTTACATCTGG + Intronic
964022364 3:152028420-152028442 AAGAACTTCAGGGGTACAAGTGG - Intergenic
969937822 4:10700067-10700089 AAAAACTTCATGAGTGTATCAGG - Intergenic
970029980 4:11663401-11663423 AAAAACTTCATGGGGTCATCTGG - Intergenic
974548435 4:63342583-63342605 AAGATCTTCACAGGTACATTTGG - Intergenic
975256745 4:72246009-72246031 AAGTACCTCATGGTCACATCAGG + Intergenic
975754049 4:77554115-77554137 AATAACTTCATGAGTAAATCTGG - Intronic
979029630 4:115625853-115625875 AAAAGCTTAATGGGGACATCAGG - Intergenic
980276523 4:130658432-130658454 AATTACTTAATGGGTACATGTGG + Intergenic
980292124 4:130857211-130857233 AAGAACTTCATGGTAACAGAAGG - Intergenic
980758685 4:137199332-137199354 GAGAACTTCAGGGGACCATCAGG - Intergenic
984217357 4:176930939-176930961 AAGATCATCATGGTTACATGAGG - Intergenic
984321788 4:178206818-178206840 AATAACTTTAGGGGTACAACTGG - Intergenic
985431276 4:189882646-189882668 AAGAGCTTCATTGGTACACTTGG - Intergenic
987168734 5:15229958-15229980 AAGAACTTTATAGGTTCATATGG + Intergenic
990685493 5:58296264-58296286 AAGAAATTCATAGGTAATTCTGG - Intergenic
992180853 5:74197078-74197100 AACAACTTCATGGGTAGGTTTGG + Intergenic
998130694 5:139649798-139649820 CCGAACTTCATGGGTAAATTTGG - Intronic
1005212870 6:23488749-23488771 AAGAACTTTATGGGTAGAGTGGG + Intergenic
1009955854 6:70452174-70452196 AAGAACTTCATTGTTTCATTTGG - Intronic
1010997788 6:82552917-82552939 AAAAACTTCATCTGTACATAGGG - Intergenic
1011833599 6:91403767-91403789 AACAACTTCAGGAGTACATGAGG + Intergenic
1020392624 7:7674813-7674835 GAAAACTTCAGGGGTACATCAGG + Intronic
1023438334 7:40161480-40161502 AACAACTTCATAGGTACTTAAGG - Intronic
1025025300 7:55511751-55511773 AAGAAGTACATTGGTTCATCCGG - Intronic
1025734668 7:64136439-64136461 AAGAAATTCATTGGTCCATGGGG - Intronic
1028052022 7:86200222-86200244 AATAACTTTAGGGGTACAACTGG + Intergenic
1028511798 7:91633465-91633487 AAGAAATTCATGGTAGCATCTGG + Intergenic
1036400143 8:8400755-8400777 AAGAAATGCATGGGGGCATCTGG - Intergenic
1041658866 8:60381383-60381405 AAGATCTTCATGGGAACACTGGG - Intergenic
1041750857 8:61259759-61259781 AAGAATTTCATGGGTATTTATGG + Intronic
1044289803 8:90454339-90454361 AGGAACTTGATGGCTACATGAGG + Intergenic
1046419202 8:113957500-113957522 GAGATCTTCATGGATATATCGGG + Intergenic
1046966375 8:120171339-120171361 AATAACTTCGTGGGCAAATCTGG - Intronic
1047283139 8:123463304-123463326 AAGAACATCTTGGGGATATCTGG - Intronic
1047331722 8:123895344-123895366 AAGGACATCATGGGTACACTTGG + Intronic
1048900961 8:139037439-139037461 AAGTACTTGATGAGTACATTTGG - Intergenic
1049974099 9:845548-845570 AAGAGCTTCTTGGGTATGTCAGG + Intronic
1053720447 9:40940664-40940686 AAGAGCTTCATTGGTACACTCGG - Intergenic
1054345536 9:63911467-63911489 AAGAGCTTCATTGGTACACTCGG + Intergenic
1054818650 9:69499743-69499765 AGGAGCTTCATGGCTTCATCTGG - Intronic
1056149114 9:83766428-83766450 AAGAACCTCACGAGTACGTCAGG + Intronic
1056784301 9:89579087-89579109 AGGATCTTCATGGTTACATTGGG - Intergenic
1057627308 9:96688893-96688915 AAAAACATCATGGAAACATCTGG + Intergenic
1059475423 9:114542839-114542861 AATAACTTGTTGGGTACATTAGG - Intergenic
1059789622 9:117626431-117626453 AAGACTTTTATGGGTACATATGG - Intergenic
1203454689 Un_GL000219v1:155204-155226 AAGAGCTTCATTGGTACACTCGG + Intergenic
1195355292 X:104033739-104033761 AAGAAGTTCATGCTTACTTCAGG + Intergenic
1195450107 X:105001704-105001726 ATAAACTTCATGGGTAAATTGGG + Intronic
1198676618 X:139138096-139138118 AAGCACTTACTGGGTACACCAGG + Intronic
1201420651 Y:13794917-13794939 AAAAGCTTCATGGGGACATGAGG + Intergenic
1202085701 Y:21134447-21134469 AAGAATTTCATGGTCATATCAGG + Intergenic