ID: 912244070

View in Genome Browser
Species Human (GRCh38)
Location 1:107942540-107942562
Sequence CAGGATACACAGATATAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 442}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912244070 Original CRISPR CAGGATACACAGATATAAAA AGG (reversed) Intronic
901283927 1:8061286-8061308 CAGGCTACACAGCTAGGAAATGG + Intergenic
901748535 1:11390941-11390963 CAGGATACACAGATGTTTGATGG - Intergenic
902303536 1:15520114-15520136 CAGGATCCACAGGGATAAGATGG + Intronic
902888054 1:19420737-19420759 CAGGATGCATAGCTTTAAAAAGG - Intronic
903399488 1:23030168-23030190 CATGATACACACAATTAAAAAGG + Intronic
904492124 1:30867738-30867760 CAGTCTGCACAGCTATAAAATGG - Intergenic
904633579 1:31861841-31861863 CAGTATCCTCAGGTATAAAATGG + Intergenic
904805411 1:33127959-33127981 CAGGATACACAGCTAATAACTGG - Intergenic
905242799 1:36591916-36591938 CAGTTTCCACAGCTATAAAATGG + Intergenic
905248450 1:36630692-36630714 CAGGGAACACAGATGTAAAAGGG - Intergenic
905456576 1:38092313-38092335 AAGGAGACACAGTTAGAAAAGGG + Intergenic
906697571 1:47833731-47833753 CAGGATATACAGGTGTGAAAGGG - Intronic
906996942 1:50806516-50806538 CAGGGTGCACATACATAAAATGG - Intronic
907023475 1:51092002-51092024 CTGAATACAAACATATAAAAAGG + Intergenic
907650170 1:56287360-56287382 CAGGATGCACAGCAATTAAATGG - Intergenic
907730577 1:57061677-57061699 AAGAATACATAGATATGAAATGG - Intronic
908597326 1:65702404-65702426 AAGGATACACGGATGTAAAATGG - Intergenic
908816511 1:68040944-68040966 CAGGATACACGGACACAATAAGG + Intergenic
909500850 1:76333897-76333919 CAGGATTCTCATCTATAAAATGG - Intronic
910268229 1:85364093-85364115 CAGTTTACTCATATATAAAATGG - Intronic
911710672 1:101068345-101068367 CAAAATACAAAGATATAGAAAGG + Intergenic
912244070 1:107942540-107942562 CAGGATACACAGATATAAAAAGG - Intronic
912651969 1:111448357-111448379 CAGGTTACACAGAAGAAAAATGG + Intronic
913286768 1:117233709-117233731 TAGGATCAACAGCTATAAAAGGG - Intergenic
914261983 1:146006706-146006728 AAGAATACAAAGATAAAAAAGGG - Intergenic
915881724 1:159679600-159679622 CAGGATAAACAGCAATAAAGGGG - Intergenic
916286161 1:163108246-163108268 CATCATACACACATATAACAAGG + Intergenic
916627438 1:166573346-166573368 CAGGATACAGATAAGTAAAAAGG + Intergenic
918958792 1:191243574-191243596 AAGGAGACACATATATTAAAGGG - Intergenic
920061699 1:203231225-203231247 CAGTTTACACAGATAGTAAATGG - Intronic
920529205 1:206689595-206689617 GAGGATACACATGTAAAAAATGG + Intronic
921119523 1:212124779-212124801 TGGGATACAGAGATATATAAAGG - Intergenic
921785858 1:219229052-219229074 CAGTTTACTCATATATAAAATGG - Intergenic
921947119 1:220893961-220893983 CAGGATAGAAAGACATAAATGGG + Intergenic
922592440 1:226787489-226787511 CAGGTTTCACATCTATAAAATGG + Intergenic
923048908 1:230376488-230376510 CAGGATACACAGCCAACAAAGGG - Intronic
923307952 1:232705540-232705562 CTGCATACACAAATATAAATTGG + Intergenic
1063171443 10:3513429-3513451 CAGTTTCCACATATATAAAATGG + Intergenic
1063874516 10:10459149-10459171 CTGAATACTCAGATATAAAGGGG + Intergenic
1065477062 10:26150630-26150652 CAGGATCTACAGATACTAAAAGG - Intronic
1065525178 10:26612926-26612948 TAGGATACATATATATAAAGGGG - Intergenic
1066642035 10:37563792-37563814 CAGGATAGACAAATATTTAAAGG + Intergenic
1067641959 10:48055531-48055553 AAGGATATACATATATATAAAGG + Intergenic
1068277972 10:54827266-54827288 CAGAATACAAATATATATAATGG + Intronic
1068286326 10:54941044-54941066 CAGAAAACACAAAAATAAAATGG - Intronic
1068548167 10:58376052-58376074 CTGGAGACACACATTTAAAAAGG - Intergenic
1069191959 10:65503599-65503621 TAGGCTACATATATATAAAAAGG + Intergenic
1070636936 10:78136498-78136520 AAGGACACACAGCTAGAAAAGGG - Intergenic
1070743332 10:78916904-78916926 CAGTTTTCACAGTTATAAAATGG + Intergenic
1072052551 10:91720651-91720673 CTGGCTACTCATATATAAAAAGG + Intergenic
1072315078 10:94194474-94194496 CCGGGTAGACAGATGTAAAAGGG - Intronic
1073196603 10:101696155-101696177 CAGGATAAACAGACAGAAATTGG - Intergenic
1073551423 10:104405573-104405595 CAAGATATACAGTTATAAATTGG - Intronic
1074024364 10:109618968-109618990 TAGGAAACACAGCTGTAAAATGG - Intergenic
1074177745 10:111027509-111027531 AAGGACACACACATACAAAAAGG - Intergenic
1074202752 10:111253730-111253752 TAGGATAGATAGATATAAAGGGG - Intergenic
1075606400 10:123814496-123814518 TAGGATAGAGAGATATATAAAGG - Intronic
1076391360 10:130105334-130105356 AAGGATACACAGCTAGTAAATGG - Intergenic
1077346695 11:2061804-2061826 CAGAAAACAGAGATTTAAAATGG - Intergenic
1077828910 11:5841783-5841805 TAAGATACACAGAGAAAAAAGGG + Exonic
1077830056 11:5857576-5857598 CAAGATACACAAAGAAAAAAGGG + Exonic
1078863733 11:15277381-15277403 CAGGGTACAGAGATGTCAAAGGG + Intergenic
1079473302 11:20801327-20801349 AAGGTTATACAGATACAAAATGG + Intronic
1079529426 11:21432155-21432177 TAGGATACACAGAAAAAAAAAGG - Intronic
1080190283 11:29537238-29537260 AAGGTTACACAGATAAAACATGG + Intergenic
1080978345 11:37369361-37369383 CAGGATAGCCACATATAGAATGG + Intergenic
1081689033 11:45063807-45063829 CAGAAAACACACATATAACAAGG + Intergenic
1081742279 11:45449032-45449054 CAGTCTACACAGAGATACAAAGG + Intergenic
1082014652 11:47475782-47475804 CAGAATAGCCAGATAGAAAATGG - Intronic
1082165915 11:48950431-48950453 ATAGAAACACAGATATAAAAGGG - Intergenic
1082610680 11:55293508-55293530 ATAGAAACACAGATATAAAAGGG + Intergenic
1082659262 11:55890168-55890190 ATAGAAACACAGATATAAAAGGG - Intronic
1083297684 11:61724016-61724038 GAGGTTACACAGCTAGAAAATGG + Intronic
1083351674 11:62033879-62033901 TAGGAAACACTGTTATAAAAAGG - Intergenic
1084634671 11:70383589-70383611 CAGCATGAACAGATTTAAAATGG + Exonic
1085822995 11:79813028-79813050 CTGGGGAAACAGATATAAAATGG + Intergenic
1086022370 11:82247094-82247116 GAGGATAGAAAGAAATAAAAAGG + Intergenic
1086600397 11:88626156-88626178 AAGGTTACAGAGATAGAAAATGG + Intronic
1086697054 11:89859706-89859728 ATAGAAACACAGATATAAAAGGG - Intergenic
1086709104 11:89984781-89984803 ATAGAAACACAGATATAAAAGGG + Intergenic
1087499519 11:98932659-98932681 CAAGACAAACAGATAAAAAAGGG - Intergenic
1087605196 11:100368810-100368832 AAGGACACACAGATATAAAGTGG + Intergenic
1088473926 11:110215830-110215852 CAGGTTACCTAGCTATAAAATGG + Intronic
1088502347 11:110495078-110495100 AAAGATACACAGATATAAGAAGG - Intergenic
1089930192 11:122302477-122302499 CAAAATTCACTGATATAAAATGG + Intergenic
1090485791 11:127110855-127110877 CAGCAGACACAGATATAAAAGGG - Intergenic
1090566916 11:128004746-128004768 GAGGATACAGAGATATACAAAGG + Intergenic
1092090720 12:5801711-5801733 GAGGAAACCCAGATACAAAAGGG + Intronic
1093048576 12:14482289-14482311 CAGGATAAATAGATATATAAAGG + Intronic
1093203538 12:16219372-16219394 AATGATTCACAGTTATAAAAAGG + Intronic
1093388680 12:18590318-18590340 CAGGATTGATAGATATAATATGG + Intronic
1093738832 12:22657278-22657300 CAAAGTACACATATATAAAAAGG + Intronic
1094042232 12:26130193-26130215 AAGGAAACACAGACATTAAAAGG - Intronic
1094151580 12:27290401-27290423 CAGGATCCACATTTCTAAAATGG - Intronic
1094214979 12:27931137-27931159 AAGGATATACAGATATAAATTGG - Intergenic
1094481137 12:30882382-30882404 CAGGAAACACAGAGACAATATGG + Intergenic
1094719711 12:33052044-33052066 GAGGATACACAGATGATAAATGG + Intergenic
1095734754 12:45544582-45544604 CAGGTTACACAGCTAGTAAATGG - Intergenic
1096343792 12:50827594-50827616 AAGGATAAACACATATAAATCGG - Intergenic
1098185063 12:67888027-67888049 CAGGATTCACATTCATAAAAGGG + Intergenic
1098345343 12:69496979-69497001 GAGGAAGCAAAGATATAAAATGG + Intronic
1098426367 12:70369182-70369204 CTGGATAAAGAGATATAAATTGG - Intronic
1099321447 12:81155376-81155398 CAGGAAAGGCAGATATAAAAAGG - Intronic
1101352098 12:103940049-103940071 CAAAATACACAGGAATAAAAAGG - Intronic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102742484 12:115220502-115220524 CATTATATACATATATAAAAAGG + Intergenic
1103034081 12:117642213-117642235 CTGGGAACACAGATATAAAAGGG - Intronic
1103203002 12:119104116-119104138 CAGTGTTCACAGCTATAAAATGG + Intronic
1103385604 12:120530007-120530029 CAGGAAACATACATTTAAAATGG - Intronic
1104090109 12:125509267-125509289 CAGGTTACACAGCTATGAAGTGG - Intronic
1104304730 12:127599475-127599497 CAGGATAAACAGATTTTCAAGGG - Intergenic
1104312815 12:127669860-127669882 CAGTATACACACATACACAATGG - Intergenic
1104327134 12:127810367-127810389 TAGGATAGATATATATAAAAAGG + Intergenic
1106629257 13:31453249-31453271 TAGGATACAAAGATACATAAAGG + Intergenic
1107162544 13:37248384-37248406 AACTATACACATATATAAAAAGG + Intergenic
1108197182 13:48006846-48006868 CAGAATACTAAGAAATAAAAAGG + Intergenic
1109379684 13:61543273-61543295 CAGGATACATGTATATATAAAGG - Intergenic
1109751570 13:66699516-66699538 GAGGAGACACAGAGAGAAAAGGG + Intronic
1110049443 13:70875938-70875960 CAGGACACAGAGATTCAAAAGGG + Intergenic
1110143950 13:72166889-72166911 CATGATAATCAGATATCAAAAGG - Intergenic
1110491617 13:76116505-76116527 GAGGATACACAGAAATGGAAAGG + Intergenic
1111233628 13:85378517-85378539 CATTATAAATAGATATAAAATGG - Intergenic
1111660903 13:91210001-91210023 CATGCTACAGAGATTTAAAAAGG + Intergenic
1112608777 13:100935080-100935102 CAGGATACACACATGTAATTGGG - Intergenic
1113411241 13:110092035-110092057 CAGGATATACTGATAGCAAATGG - Intergenic
1113861226 13:113489028-113489050 AAGGATACCCATATGTAAAATGG + Intronic
1115075628 14:29386420-29386442 CTGCATACATAGATATAAAGGGG - Intergenic
1115995434 14:39190842-39190864 CAAGATCCACAGATGTAAGAAGG - Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116306972 14:43268540-43268562 CAGGATATAGAGACATACAATGG + Intergenic
1120164080 14:81175532-81175554 CAGGATAAAAAAATACAAAAAGG + Exonic
1122082973 14:99279651-99279673 CAACACACACACATATAAAAAGG - Intergenic
1122874577 14:104657941-104657963 CAGGAGACACAGATCTAGCAAGG + Intergenic
1123799622 15:23806397-23806419 CAGAAAACTCAGACATAAAAAGG - Intergenic
1124215120 15:27800514-27800536 CAGATTATACAGATATTAAAAGG + Intronic
1125345139 15:38711752-38711774 AAGGATACATACATACAAAATGG + Intergenic
1125886611 15:43234388-43234410 AAGGATACACAGCCAAAAAATGG + Intronic
1125989294 15:44090097-44090119 CAGGATAGACAAGTTTAAAATGG - Intronic
1126015051 15:44342745-44342767 CCAGATACAAAGATATGAAATGG - Intronic
1126378765 15:48024061-48024083 CAGGATGCCAAGACATAAAATGG + Intergenic
1126957678 15:53952359-53952381 AAGGTTACACACAAATAAAAAGG + Intergenic
1127692307 15:61409363-61409385 CAGCATCCACATTTATAAAATGG + Intergenic
1128207581 15:65866943-65866965 TAGGATAGACACATATATAAAGG + Intronic
1129016437 15:72473597-72473619 CAGGTTCCTCAGGTATAAAATGG + Intergenic
1130580116 15:85129530-85129552 CAGGTTTCATAGAAATAAAAAGG - Intronic
1130685007 15:86029559-86029581 CAGAATGCAAAGATAAAAAAAGG - Intergenic
1131090176 15:89618590-89618612 CGGAATACACAGATACATAAGGG - Intronic
1131345037 15:91638535-91638557 TGAGATACACAGATATTAAACGG - Intergenic
1133139452 16:3733435-3733457 CAGGATTCAGAGACAGAAAAGGG + Intronic
1134289208 16:12890130-12890152 CAGGAAAGACAGAAACAAAAAGG + Intergenic
1135856687 16:26018152-26018174 CTGGCCACACAGAGATAAAAAGG - Intronic
1137344231 16:47639594-47639616 CAGAGTACTCAGATCTAAAATGG - Intronic
1138571874 16:57879652-57879674 GAGATGACACAGATATAAAAGGG + Intergenic
1138584048 16:57959059-57959081 AAGGATACATATATTTAAAATGG - Intronic
1139124419 16:64060779-64060801 CAGGATACAAACATTTTAAATGG - Intergenic
1139159785 16:64490547-64490569 AAAAATATACAGATATAAAAAGG + Intergenic
1139724806 16:68888580-68888602 CTGGAAACAGAGAGATAAAATGG - Intronic
1141000215 16:80300730-80300752 CAGGAAACACAGAAAAAAAAAGG + Intergenic
1143346001 17:6249728-6249750 CAGGACACACAGATAATAAATGG + Intergenic
1144290819 17:13824571-13824593 CATGATACCGACATATAAAATGG - Intergenic
1145121560 17:20264780-20264802 CTGGATACATATACATAAAAAGG + Intronic
1146087443 17:29842981-29843003 CAACATACACAAATAGAAAAAGG - Intronic
1146212148 17:30951015-30951037 CACCATACACAGACATTAAATGG - Intronic
1146654173 17:34625672-34625694 CAGGATACACAGGGATCACAGGG + Intronic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1148565069 17:48627729-48627751 CAGAATAGATATATATAAAAAGG - Intronic
1149781651 17:59402129-59402151 CAGCATTCACAGTTATAACATGG + Intergenic
1149982865 17:61325292-61325314 CAGGCCCCACAGATATGAAAAGG - Intronic
1150097069 17:62386694-62386716 CAGGTTATACAGATAGTAAATGG - Intronic
1150340435 17:64362330-64362352 CAGGATACAGATTTAAAAAATGG + Intronic
1150355976 17:64485054-64485076 AAGGATAGTGAGATATAAAAAGG - Intronic
1153937121 18:9937913-9937935 CAGGATAAGCAGAAATGAAAAGG + Intronic
1154029709 18:10742575-10742597 CAGGCAACAGAAATATAAAAAGG - Exonic
1155082171 18:22420945-22420967 TAGAATACACAGATTTATAAAGG + Intergenic
1155649241 18:28120644-28120666 TAAAACACACAGATATAAAAGGG + Intronic
1158197542 18:54905600-54905622 CTGGATTCACAAATATACAATGG - Intronic
1158768623 18:60486714-60486736 CATGATACATAGATCTAAGAAGG - Intergenic
1159055336 18:63457998-63458020 CAGCTTACACAAAAATAAAATGG + Intergenic
1159254154 18:65924034-65924056 CAGGATACACATATGAACAATGG + Intergenic
1159733212 18:72058761-72058783 AAAAATACACAGATATAACAAGG + Intergenic
1159799986 18:72886673-72886695 TATGATACACAGCAATAAAATGG + Intergenic
1160376011 18:78412647-78412669 CAGAATACACTGATATGTAAAGG - Intergenic
1161805266 19:6439909-6439931 CAGTTTACACATCTATAAAATGG - Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164830415 19:31315623-31315645 TATGATAAACAGAAATAAAAAGG + Intronic
1164848502 19:31458057-31458079 AGGGATACACATATCTAAAAAGG - Intergenic
1165560266 19:36673020-36673042 CATGATAAAGAGATATGAAAGGG - Intergenic
1165680856 19:37773905-37773927 CAGGAAACCCAGCTATACAAAGG + Intronic
1165914857 19:39251914-39251936 CAAGATACACAGCTAATAAATGG + Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
924996127 2:363570-363592 CATGATATAAAGATAGAAAACGG - Intergenic
925440708 2:3883012-3883034 TAGGATAGATAGATATATAATGG - Intergenic
925483097 2:4298177-4298199 CAGTTTAAACAGAGATAAAATGG + Intergenic
925964415 2:9050575-9050597 CAGGAAACACACATACAAATAGG - Intergenic
926249673 2:11147309-11147331 CAGTCTCCACAGTTATAAAATGG + Intergenic
926666526 2:15530146-15530168 CAGGAGCCACACATATCAAAAGG + Intronic
927535019 2:23849079-23849101 CAGCAGACACAAATAGAAAATGG + Intronic
928158588 2:28899786-28899808 CAGGATAAGCATATTTAAAAAGG - Intronic
928194470 2:29205226-29205248 AAGAAAACACACATATAAAAAGG - Intronic
928239235 2:29572197-29572219 CAGGATAAACAAATCCAAAATGG - Intronic
928361634 2:30666744-30666766 CAGTATTTACAGATAGAAAAAGG - Intergenic
928975049 2:37077744-37077766 CAAGATAGAGACATATAAAATGG - Intronic
929244995 2:39691879-39691901 AAGCATACACACATATATAATGG + Intronic
930899895 2:56492980-56493002 AATGATATAAAGATATAAAAGGG - Intergenic
931671415 2:64652254-64652276 CAGAATAGACTGCTATAAAAAGG + Intronic
932975372 2:76593685-76593707 CAGGATTCACAAATGAAAAATGG - Intergenic
933469414 2:82702261-82702283 CAGGATACACAGTTCCAAAAGGG + Intergenic
933588270 2:84203246-84203268 CAGGAGAGACAGAAAGAAAATGG + Intergenic
934593366 2:95579340-95579362 ATAGAAACACAGATATAAAAGGG - Intergenic
934995457 2:98954157-98954179 CAGGATAGACATATATATCAAGG + Intergenic
935624480 2:105159547-105159569 CAGATCACACAGATATCAAAAGG + Intergenic
936253275 2:110885705-110885727 CAAAATACAGAGGTATAAAAAGG - Intronic
937554433 2:123135465-123135487 GAGAATACATAGATATAAAAAGG - Intergenic
937837699 2:126489410-126489432 AAGGAAACACTGAAATAAAATGG - Intergenic
938881097 2:135589901-135589923 TAATATACATAGATATAAAAAGG + Intronic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
940334848 2:152515247-152515269 ATGAATACACAAATATAAAACGG - Intronic
940386222 2:153075955-153075977 AATACTACACAGATATAAAAAGG - Intergenic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
940514732 2:154668133-154668155 TATAATACACACATATAAAAGGG - Intergenic
940528649 2:154849963-154849985 CAATATTCACAGATTTAAAAGGG - Intronic
940867200 2:158829352-158829374 CAGGAGACACAGCTGCAAAAGGG + Intronic
941465055 2:165815667-165815689 CAGCAAATAGAGATATAAAATGG + Intergenic
941478812 2:165980710-165980732 AAGAATAAACAGATTTAAAATGG + Intergenic
941600325 2:167535593-167535615 CAGAACACATAGGTATAAAAAGG + Intergenic
943422654 2:187686910-187686932 CAGCAAACACAGATATGATATGG - Intergenic
943497535 2:188641607-188641629 CAGAATACATAGAAATAAAATGG + Intergenic
943535017 2:189137977-189137999 TAGGATATACATATATAAAATGG + Intronic
944189566 2:196987402-196987424 CAGAATATACAAATATAAAAAGG + Intronic
944238624 2:197464195-197464217 GAGGATACACATGTAGAAAAGGG + Intronic
944584833 2:201164352-201164374 TAGGATACATGTATATAAAAAGG + Exonic
945579618 2:211577034-211577056 GAGGTTACTCAGATATATAATGG + Intronic
946879060 2:224159517-224159539 CAGGATAGAGAGAGAGAAAAAGG + Intergenic
948168874 2:235884799-235884821 CAGAATCCACAGATAACAAAAGG + Intronic
1169537114 20:6556981-6557003 CAGTTTACTCAGCTATAAAATGG + Intergenic
1170277733 20:14611203-14611225 AAGGAAACACAGGTATAAAATGG - Intronic
1170479733 20:16754042-16754064 AAGTATACACAGCTAGAAAACGG - Intronic
1170958164 20:21000779-21000801 TAGGATACATAGATACATAAAGG + Intergenic
1173400297 20:42720299-42720321 CAGTATTCACATATGTAAAATGG - Intronic
1175557534 20:59879296-59879318 CAGGATTATCATATATAAAAGGG - Intronic
1175574072 20:60047307-60047329 CAAGATACTCACCTATAAAATGG - Intergenic
1177091848 21:16779185-16779207 CAGGATTTAAAGATATAAAGGGG + Intergenic
1177208561 21:18040727-18040749 CAAGATACACTAAAATAAAATGG - Intronic
1177733236 21:25056407-25056429 CAGGACACAAAGATACAAAGTGG + Intergenic
1178085725 21:29110384-29110406 AAAGATACAGAGATAAAAAACGG - Intronic
1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG + Intronic
1178412953 21:32380879-32380901 CAGGATAGAAAGATGTAGAATGG - Intronic
1181841418 22:25665590-25665612 CTGGCTAAACAGATATAGAATGG + Intronic
1183393176 22:37557277-37557299 CAGCTTACCCAGATGTAAAAGGG + Intergenic
1183934053 22:41251993-41252015 GAGGTTACAGAGAAATAAAATGG - Intronic
1184632201 22:45790790-45790812 CAGGATAAAAAGATATAAAGAGG - Intronic
949091323 3:32944-32966 CAGGAAACTCAGATCTAAGAGGG + Intergenic
949741281 3:7237412-7237434 CTGGATACCCAGATTTTAAAGGG - Intronic
950286529 3:11749684-11749706 CAGGACACCCAGATATGAAGCGG + Intergenic
950486858 3:13278947-13278969 CAGGTTCCACATCTATAAAATGG + Intergenic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
952266019 3:31787166-31787188 AAGGATACACAAATATCACAAGG + Intronic
952393296 3:32899378-32899400 CTGGATAAACAGCCATAAAAAGG + Intergenic
952698473 3:36298570-36298592 TAGGATAGATAGATATATAAAGG + Intergenic
956277634 3:67520329-67520351 CTGGATACCCAGAAAGAAAAAGG + Intronic
956870434 3:73411792-73411814 CCGGACACTCATATATAAAAAGG - Intronic
956875268 3:73456973-73456995 CAGGATACATACATTTTAAATGG - Intronic
957021046 3:75126469-75126491 CAGGAAACACAGGTAGAGAATGG + Intergenic
957031641 3:75249169-75249191 CAGGAAACTCAGATCTAAGAGGG + Intergenic
957955075 3:87176005-87176027 CTGGTTATACAGATAGAAAATGG - Intergenic
958579320 3:95997152-95997174 CTGGATTCCCAGATATAGAAAGG - Intergenic
958660600 3:97061844-97061866 CTGGAAATACAGACATAAAAAGG + Intronic
959403758 3:105935574-105935596 AAGCATAAACATATATAAAAAGG - Intergenic
962228790 3:133641264-133641286 CAGGAGACCCAAATGTAAAAAGG - Intronic
962480126 3:135790827-135790849 CAGGATACCCAGTTAAAAATTGG - Intergenic
962539566 3:136365259-136365281 TAGGATAAACACTTATAAAATGG + Intronic
962945878 3:140170066-140170088 CAGGAAACAAAAATATACAAGGG + Intronic
963155880 3:142096566-142096588 TAAGATACATATATATAAAATGG + Intronic
965175423 3:165324181-165324203 CATTACACACAGATTTAAAAAGG - Intergenic
965392780 3:168125614-168125636 CAGCCAACACACATATAAAAAGG - Intergenic
965640227 3:170822601-170822623 CAGGAGACAGAGATATAAGAGGG + Intronic
966025885 3:175280845-175280867 CAGGATAAAAAGATTAAAAATGG - Intronic
966181347 3:177191684-177191706 AAGAATACACAGATAAAAAGTGG + Intronic
967065448 3:185911234-185911256 CAGGTTACACTGATACACAATGG - Intergenic
967074725 3:185991716-185991738 CAGGTTACACTGATACACAATGG - Intergenic
967672190 3:192250192-192250214 CAGAATAAACAGAAATAGAAAGG - Intronic
967704516 3:192633918-192633940 AACGATATACAGTTATAAAAAGG - Intronic
967753258 3:193139332-193139354 CAGGAAAAACAAACATAAAATGG + Intergenic
967964970 3:194953862-194953884 TAGGATAGATAGATATATAAAGG + Intergenic
968657862 4:1786401-1786423 CACGATACCCAGCTGTAAAATGG + Intergenic
968753110 4:2400551-2400573 TAGGATACATATATATAAAGGGG + Intronic
969260631 4:6031088-6031110 CAGCATACACATAAATAGAAGGG + Intronic
969723161 4:8904464-8904486 CAGGAGAGACAGAGAGAAAAGGG + Intergenic
969876980 4:10142796-10142818 ATGGATACACACATATAAAGGGG + Intergenic
970122051 4:12765674-12765696 TAAAATACACAGAAATAAAAAGG - Intergenic
970355585 4:15248527-15248549 CAGGATGAACAGATATCTAACGG + Intergenic
970477365 4:16437262-16437284 TAGGATAGACATATATATAAAGG + Intergenic
970773689 4:19647401-19647423 TAGGATACACGTATATATAAAGG + Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971566241 4:28145193-28145215 CAGGAAACAGAGAGATAATAGGG + Intergenic
971927501 4:33032109-33032131 CAGTATACACAGACATAACATGG + Intergenic
972066369 4:34950884-34950906 ATTGATACACAGATATAAAAAGG - Intergenic
972276929 4:37566110-37566132 CAGGATAGACATATATGTAAAGG - Intronic
972293283 4:37712423-37712445 CAAGATACACAGCTAGCAAACGG + Intergenic
972657548 4:41079361-41079383 CAGGATACACAGGTAGAGATAGG + Intronic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
972848478 4:43019033-43019055 CAAGATAGACTGAAATAAAATGG + Intronic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
974479441 4:62424188-62424210 CAGGATACATGTATATATAAAGG + Intergenic
974560673 4:63512682-63512704 CAGTATACTAATATATAAAAAGG + Intergenic
974660690 4:64884538-64884560 CAGGGTACATAGAGCTAAAATGG - Intergenic
975145174 4:70959049-70959071 CAGGCTACTGAGAAATAAAAAGG - Intronic
975650195 4:76585386-76585408 CAGCACACACAGAAAGAAAATGG - Intronic
976582795 4:86758946-86758968 CACTATTCACAGATATCAAACGG - Exonic
976908900 4:90276125-90276147 CAGGAGACACACACACAAAATGG - Intronic
978103255 4:104869568-104869590 CATGTTATACAGATATAAAGTGG + Intergenic
979045798 4:115861587-115861609 CAGGAAAAATATATATAAAAAGG - Intergenic
979128771 4:117012089-117012111 CATTATACACAAATATATAAAGG - Intergenic
979554400 4:122028521-122028543 AAGGATACACAGTCATAGAACGG - Intergenic
979587246 4:122435359-122435381 CAAGAAACACAGATTTAAATTGG - Intergenic
979822416 4:125191191-125191213 CAGGATACACAGGAATGGAATGG + Intergenic
981298368 4:143158712-143158734 CAGGCTTCTCATATATAAAATGG - Intergenic
981592856 4:146383706-146383728 CAGGTTTCTCAGCTATAAAATGG - Intronic
981916572 4:150040413-150040435 CAGTATATACAGATTGAAAAGGG + Intergenic
982306638 4:153939112-153939134 CTGGGGACACAGATATAAACAGG + Intergenic
982391110 4:154864743-154864765 CAGGATAGATACATATATAAAGG + Intergenic
982444172 4:155470963-155470985 CAGAGAACACACATATAAAAAGG + Intergenic
982678270 4:158400580-158400602 CAGGACATACAGATATAGACTGG - Intronic
983330653 4:166323744-166323766 CAGGATACATATATGTAGAATGG - Intergenic
983617196 4:169720577-169720599 AAGGATACACCGATTTAAAGAGG - Intronic
984496829 4:180508685-180508707 CAGTAGACACAGCTATACAATGG - Intergenic
985122787 4:186660717-186660739 CAGAATAGAGAGATTTAAAAGGG + Intronic
985876163 5:2598027-2598049 TAGGATAAAGAGAAATAAAAGGG + Intergenic
986347430 5:6847761-6847783 CATTATACACAGCCATAAAAAGG - Intergenic
986906287 5:12497571-12497593 TAGGATAGACAAATATAAAGGGG + Intergenic
986990290 5:13544861-13544883 CACGATACACAAGAATAAAATGG - Intergenic
987266390 5:16260164-16260186 CAGGATACACAGATATTGTCTGG + Intergenic
988001271 5:25352179-25352201 CCAGATAAACAGATATAAAAAGG + Intergenic
988392101 5:30647659-30647681 CAGGATAATCATATGTAAAAAGG + Intergenic
988882457 5:35517908-35517930 CAGGCATCAAAGATATAAAAAGG + Intergenic
989317209 5:40095427-40095449 CAGGATTCACAGAGATATATGGG + Intergenic
989351596 5:40493254-40493276 CAGGACACACAGAAAGGAAAGGG + Intergenic
989436604 5:41420737-41420759 CATGAAACACAGATACAAAATGG + Intronic
989478331 5:41900138-41900160 GAGAAGACACAGATATAAGATGG - Intergenic
989992723 5:50787005-50787027 CAGGAGACACAGGTTTGAAAAGG - Intronic
990078420 5:51880839-51880861 CAGAACAAACAGTTATAAAAAGG - Intergenic
990474803 5:56152011-56152033 GGGGATACAAAGATAAAAAAAGG + Intronic
992536068 5:77704992-77705014 CTACATACACAGATGTAAAAGGG - Intronic
993315868 5:86405564-86405586 CAGGATACTCAGATAGGGAAAGG - Intergenic
993643596 5:90435868-90435890 AAGTTTACACACATATAAAATGG + Intergenic
994497036 5:100525998-100526020 GAGGATGCAAAGACATAAAAAGG + Intergenic
994656590 5:102601693-102601715 TAGGAAACACAGATGTCAAAAGG + Intergenic
994742149 5:103633733-103633755 CAGAAGATACAGATATAAACTGG - Intergenic
994855890 5:105118474-105118496 TAGGATAGACATATATATAAAGG - Intergenic
996818607 5:127600463-127600485 TAGGGTACACATATATACAACGG - Intergenic
997836538 5:137198437-137198459 CTGGATAAACAGCTATCAAAGGG + Intronic
997966889 5:138364784-138364806 CAGGCTACACAGTTAAGAAATGG + Intronic
998576367 5:143321870-143321892 CAGGATACATATACATCAAAAGG - Intronic
999254384 5:150201942-150201964 CAGGCTGCACAGCTAGAAAATGG + Intronic
999881482 5:155869494-155869516 CAGTATCCACATCTATAAAATGG - Intergenic
1000161795 5:158604974-158604996 CAGGCTACAGGGATATAATAAGG - Intergenic
1000396301 5:160778031-160778053 AAGGATACACACATACAAAGTGG + Intronic
1000644793 5:163748239-163748261 CAGTATATACAGCTAAAAAAAGG + Intergenic
1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG + Intergenic
1001484098 5:172107165-172107187 GAGGAGAAACAGGTATAAAAGGG + Intronic
1001540960 5:172539029-172539051 AAGGATATACAGAAATATAAGGG - Intergenic
1001735951 5:174001635-174001657 CAGGATACTAAGACATAAAAAGG - Intronic
1003150481 6:3543846-3543868 CAGGATAGATAGATATAAGTAGG - Intergenic
1004266560 6:14153173-14153195 GAGGATATACAGAAATAAATAGG + Intergenic
1004986095 6:21084705-21084727 TAGGATAAACAAATATAAAGAGG + Intronic
1006068281 6:31478131-31478153 CAGGGTCCACAGAGATATAAGGG + Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1007525704 6:42490675-42490697 CAGGATATAAAAATATAAGAAGG + Intergenic
1008015469 6:46513704-46513726 CAGAACACTCAGCTATAAAAAGG + Intergenic
1009448047 6:63766772-63766794 CAGGATTGAGAGACATAAAATGG - Intronic
1010145741 6:72667668-72667690 CAGGATACATGTATATCAAATGG + Intronic
1010595673 6:77760687-77760709 CAGGATACACTAATCTAACAAGG + Intronic
1010635864 6:78258866-78258888 CAAGATACATAAAAATAAAAGGG - Intergenic
1010646629 6:78396793-78396815 CAGGCTACTCAAATATAATATGG + Intergenic
1010946391 6:81978781-81978803 CATGATACAAATATATATAAAGG + Intergenic
1011150158 6:84263410-84263432 CAGTATTCTCATATATAAAAGGG - Intergenic
1011303212 6:85898208-85898230 CAGGATACACTCAGATAAATTGG + Intergenic
1011394255 6:86889834-86889856 CAGGGTACAGAGATACAAAGTGG + Intergenic
1012038488 6:94173341-94173363 CTGGACACACAGCCATAAAAAGG + Intergenic
1012386203 6:98686027-98686049 CAGGAAAAACAGGAATAAAATGG + Intergenic
1012921221 6:105222799-105222821 TAGGATAGACATATATATAAAGG + Intergenic
1013362962 6:109411519-109411541 CTGGTTACACAGATATAACCAGG + Intronic
1014447873 6:121549592-121549614 CAGGGAGCACAGATCTAAAATGG + Intergenic
1014497297 6:122141455-122141477 AAGGACACACAGATAGAAAAAGG - Intergenic
1014519290 6:122420533-122420555 CTGGATTCACATATACAAAATGG - Intronic
1015298486 6:131626656-131626678 CAAAATGCACAGGTATAAAAGGG - Intronic
1015540313 6:134306892-134306914 GAGAATACAAAGAAATAAAAGGG + Intronic
1016943453 6:149504253-149504275 CATGAAACACAGAGAGAAAAAGG + Intergenic
1017573118 6:155769753-155769775 CAGAACACACAGATATAAACAGG - Intergenic
1017991107 6:159490549-159490571 GAGGATACACAGAAACAAATGGG - Intergenic
1020248069 7:6446164-6446186 CATGATACAAAGAAATAAAAGGG + Intronic
1020793388 7:12653954-12653976 CAGTATATACTGATATACAATGG - Intergenic
1021053108 7:16013636-16013658 AAGCATACAAAAATATAAAATGG - Intergenic
1022945893 7:35283120-35283142 CAGGCCACACAGATACATAAAGG - Intergenic
1023525613 7:41099516-41099538 CAGAATTCACAGATACAACAGGG + Intergenic
1023646459 7:42321857-42321879 GAAGATATACAGATATGAAAAGG - Intergenic
1024891141 7:54204920-54204942 CAGGATACCCAAAGATGAAAGGG + Intergenic
1025138644 7:56443171-56443193 TAGCAAACACATATATAAAAAGG + Intergenic
1025980870 7:66404704-66404726 TAGGTTGCACACATATAAAATGG - Intronic
1027660578 7:80983595-80983617 AAGGATAAACACATAGAAAAGGG + Intergenic
1027911336 7:84255313-84255335 CAGTTTAGAGAGATATAAAATGG - Intronic
1028796988 7:94914026-94914048 AAAGAAACACAGATAGAAAATGG - Intronic
1028840299 7:95422415-95422437 CAATATAGAAAGATATAAAATGG - Intronic
1031062293 7:117065615-117065637 ACAGATACACAGAAATAAAAAGG - Intronic
1031788118 7:126060448-126060470 CCGAATACACAAACATAAAAGGG - Intergenic
1032660274 7:133975868-133975890 AAGGACACACAGCTATTAAATGG + Intronic
1032987903 7:137359277-137359299 CTGGATACATAGATATAACCAGG - Intergenic
1033023314 7:137749347-137749369 CAGGGTCCACAGAAATGAAAGGG - Intronic
1033354268 7:140586691-140586713 CGGGATTCCCAGATCTAAAATGG - Intronic
1033990891 7:147285320-147285342 CAGTAAACACAGGTATAAAAAGG + Intronic
1034037417 7:147838924-147838946 TAGGATAGACATATATATAAAGG + Intronic
1038094658 8:24294431-24294453 GAGAATATACAGAAATAAAAGGG + Intronic
1038958642 8:32494792-32494814 CTGGATGCACAGACACAAAAGGG - Intronic
1039041871 8:33416151-33416173 CAGAAGAAACAGAAATAAAATGG + Intronic
1041009098 8:53523985-53524007 CAGCAGACACAGAGTTAAAAGGG - Intergenic
1041013982 8:53572236-53572258 CATTATACATAGATATAAGAAGG - Intergenic
1041570780 8:59334892-59334914 CATGGTACAGAAATATAAAAAGG + Intergenic
1041884905 8:62797496-62797518 CAGGAGACACAGGTAAACAATGG - Intronic
1041938313 8:63359067-63359089 GAGGACACACAGCTAGAAAATGG - Intergenic
1042181585 8:66093008-66093030 GAGCACACACAGACATAAAATGG - Intronic
1042218851 8:66453590-66453612 CAGCAACCACAGATATAAAGAGG + Intronic
1042758466 8:72244527-72244549 CAGCATACTCAGCTATGAAATGG + Intergenic
1042931006 8:74014106-74014128 CAGGATACACTGATTTAATGTGG + Intronic
1043764628 8:84114826-84114848 AAGGAAACAAAGATATAGAATGG + Intergenic
1043788849 8:84437204-84437226 AATGCTACACAGCTATAAAAAGG - Intronic
1045180202 8:99772688-99772710 CAGTATACACATATAAAACAGGG - Intronic
1046373567 8:113345821-113345843 CAGGTTATACAGCTTTAAAATGG + Intronic
1046441143 8:114255714-114255736 CCAGATGCACAGATACAAAAAGG + Intergenic
1047550912 8:125871323-125871345 CAGGATAGATATATATAAAGAGG + Intergenic
1047869072 8:129062305-129062327 CAGAATACACTGAACTAAAAGGG + Intergenic
1048113170 8:131489932-131489954 CATGATCTACAGATATAATATGG + Intergenic
1050209510 9:3237758-3237780 CAGGGTGCAAAGATATTAAATGG + Intronic
1051861961 9:21635782-21635804 CAGAATACACAGGATTAAAAAGG - Intergenic
1052196185 9:25717770-25717792 CAAAATCCTCAGATATAAAATGG - Intergenic
1053362237 9:37496847-37496869 CTGGACTCACAGAGATAAAAAGG - Intronic
1054719171 9:68586423-68586445 CTGTATATACATATATAAAATGG - Intergenic
1054921023 9:70542149-70542171 CAGGTGTCACAGATATAAACAGG + Intronic
1055413458 9:76056503-76056525 CATGATACACAGAAATTAACAGG + Intronic
1057570606 9:96201599-96201621 CAGGAGCCACAGATGTGAAATGG + Intergenic
1057963005 9:99475129-99475151 TAGGATACAAAGTGATAAAAAGG + Intergenic
1058549930 9:106103805-106103827 TAGGATAGATAGATATATAAAGG - Intergenic
1058785156 9:108379622-108379644 CAGGATAAACAGTTAGAAATAGG - Intergenic
1058953449 9:109924716-109924738 CAGCAGAAACAGTTATAAAATGG - Intronic
1059135738 9:111804310-111804332 CAGAATACAAACAGATAAAAAGG + Intergenic
1059614458 9:115933471-115933493 CAGGGGACACAGTGATAAAAAGG - Intergenic
1059614508 9:115934183-115934205 GAGGATACACAGCTATGTAATGG - Intergenic
1059788479 9:117613225-117613247 CAGTTTTCACAGCTATAAAATGG + Intergenic
1059877455 9:118650966-118650988 GAGTATACACAAATATAGAATGG - Intergenic
1062154865 9:135041668-135041690 AAAAAGACACAGATATAAAATGG - Intergenic
1062218016 9:135399567-135399589 CAGGAGGCACAGATATCACACGG + Intergenic
1185840581 X:3386484-3386506 CAGGACACCCAGAGATAAACTGG + Intergenic
1186633181 X:11373212-11373234 CAGGATACACAGATGTTAGTAGG + Intronic
1187406058 X:19005066-19005088 AAGGACACACAGATAGAAAGTGG + Intronic
1187489770 X:19739989-19740011 CAGAAGACACAGAGATAGAAAGG + Intronic
1187598934 X:20805439-20805461 CAGAAAACACAGAGATAAAAGGG + Intergenic
1188089385 X:25944460-25944482 CAGCAGAAACAGTTATAAAAAGG + Intergenic
1189502113 X:41571470-41571492 CAGAGTCTACAGATATAAAAAGG - Intronic
1190096386 X:47484091-47484113 CAGGAAACACACATTTTAAAAGG - Exonic
1191014539 X:55794393-55794415 CAGAATTCACAGATCCAAAAAGG - Intergenic
1192997916 X:76532192-76532214 CAGCATACACAAGTATAAACAGG - Intergenic
1193291582 X:79779311-79779333 CAGTTTACACATCTATAAAAAGG - Intergenic
1193326311 X:80181898-80181920 CTAGTTACACAGATATAACAAGG + Intergenic
1193551842 X:82903267-82903289 GAGTATACATAGATACAAAAAGG + Intergenic
1193556868 X:82964679-82964701 AAGGAAACACAAATATAAAGTGG - Intergenic
1194007732 X:88517746-88517768 CAGGGTAAACAGATATAATGAGG - Intergenic
1196109056 X:111926755-111926777 AAGGTTACACAGCTATTAAATGG + Intronic
1197062536 X:122198498-122198520 CAGGATAGATGTATATAAAAAGG + Intergenic
1198469747 X:136935098-136935120 CAGCAGACACAGAGTTAAAAAGG - Intergenic
1199353675 X:146834958-146834980 TAGGATATACATATAGAAAAGGG - Intergenic
1199754255 X:150849721-150849743 CAGGATGTACTGATATACAAGGG - Intronic
1200326079 X:155240996-155241018 CAGAATACACAGAAATATCAAGG - Intergenic