ID: 912244766

View in Genome Browser
Species Human (GRCh38)
Location 1:107949723-107949745
Sequence CTGTGTGTGTACATGTACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912244766_912244767 21 Left 912244766 1:107949723-107949745 CCAAAGTACATGTACACACACAG No data
Right 912244767 1:107949767-107949789 CAACTTATGCATTTCTTGTGTGG 0: 1
1: 0
2: 3
3: 15
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912244766 Original CRISPR CTGTGTGTGTACATGTACTT TGG (reversed) Intronic
No off target data available for this crispr