ID: 912244766 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:107949723-107949745 |
| Sequence | CTGTGTGTGTACATGTACTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 912244766_912244767 | 21 | Left | 912244766 | 1:107949723-107949745 | CCAAAGTACATGTACACACACAG | No data | ||
| Right | 912244767 | 1:107949767-107949789 | CAACTTATGCATTTCTTGTGTGG | 0: 1 1: 0 2: 3 3: 15 4: 206 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 912244766 | Original CRISPR | CTGTGTGTGTACATGTACTT TGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||