ID: 912250570

View in Genome Browser
Species Human (GRCh38)
Location 1:108008238-108008260
Sequence TCAGATCCACAGATAGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912250569_912250570 2 Left 912250569 1:108008213-108008235 CCAGGAAATGTCTTGTATTGGAT No data
Right 912250570 1:108008238-108008260 TCAGATCCACAGATAGTGCCAGG No data
912250567_912250570 15 Left 912250567 1:108008200-108008222 CCTTGGTAAAGTGCCAGGAAATG No data
Right 912250570 1:108008238-108008260 TCAGATCCACAGATAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912250570 Original CRISPR TCAGATCCACAGATAGTGCC AGG Intergenic
No off target data available for this crispr