ID: 912252026

View in Genome Browser
Species Human (GRCh38)
Location 1:108021352-108021374
Sequence GACAGCTCTTGGGTTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912252026_912252032 16 Left 912252026 1:108021352-108021374 CCAGTAACAACCCAAGAGCTGTC No data
Right 912252032 1:108021391-108021413 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
912252026_912252031 15 Left 912252026 1:108021352-108021374 CCAGTAACAACCCAAGAGCTGTC No data
Right 912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225
912252026_912252030 11 Left 912252026 1:108021352-108021374 CCAGTAACAACCCAAGAGCTGTC No data
Right 912252030 1:108021386-108021408 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912252026 Original CRISPR GACAGCTCTTGGGTTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr