ID: 912252459

View in Genome Browser
Species Human (GRCh38)
Location 1:108025722-108025744
Sequence CTGCAGCCACAGCTGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912252459_912252461 -6 Left 912252459 1:108025722-108025744 CCTTGCTCCAGCTGTGGCTGCAG No data
Right 912252461 1:108025739-108025761 CTGCAGTGATCAATTCTCTTCGG No data
912252459_912252464 17 Left 912252459 1:108025722-108025744 CCTTGCTCCAGCTGTGGCTGCAG No data
Right 912252464 1:108025762-108025784 GCTTTGACCAGCTTTCCCTAGGG No data
912252459_912252463 16 Left 912252459 1:108025722-108025744 CCTTGCTCCAGCTGTGGCTGCAG No data
Right 912252463 1:108025761-108025783 GGCTTTGACCAGCTTTCCCTAGG No data
912252459_912252465 18 Left 912252459 1:108025722-108025744 CCTTGCTCCAGCTGTGGCTGCAG No data
Right 912252465 1:108025763-108025785 CTTTGACCAGCTTTCCCTAGGGG No data
912252459_912252462 -5 Left 912252459 1:108025722-108025744 CCTTGCTCCAGCTGTGGCTGCAG No data
Right 912252462 1:108025740-108025762 TGCAGTGATCAATTCTCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912252459 Original CRISPR CTGCAGCCACAGCTGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr