ID: 912252465

View in Genome Browser
Species Human (GRCh38)
Location 1:108025763-108025785
Sequence CTTTGACCAGCTTTCCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912252459_912252465 18 Left 912252459 1:108025722-108025744 CCTTGCTCCAGCTGTGGCTGCAG No data
Right 912252465 1:108025763-108025785 CTTTGACCAGCTTTCCCTAGGGG No data
912252458_912252465 19 Left 912252458 1:108025721-108025743 CCCTTGCTCCAGCTGTGGCTGCA No data
Right 912252465 1:108025763-108025785 CTTTGACCAGCTTTCCCTAGGGG No data
912252460_912252465 11 Left 912252460 1:108025729-108025751 CCAGCTGTGGCTGCAGTGATCAA No data
Right 912252465 1:108025763-108025785 CTTTGACCAGCTTTCCCTAGGGG No data
912252457_912252465 20 Left 912252457 1:108025720-108025742 CCCCTTGCTCCAGCTGTGGCTGC No data
Right 912252465 1:108025763-108025785 CTTTGACCAGCTTTCCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912252465 Original CRISPR CTTTGACCAGCTTTCCCTAG GGG Intergenic
No off target data available for this crispr