ID: 912255302

View in Genome Browser
Species Human (GRCh38)
Location 1:108052467-108052489
Sequence TCACTTCGATTGGGTGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912255296_912255302 25 Left 912255296 1:108052419-108052441 CCATGAAGAAAATAAAACAAGCT No data
Right 912255302 1:108052467-108052489 TCACTTCGATTGGGTGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912255302 Original CRISPR TCACTTCGATTGGGTGTTCA GGG Intergenic