ID: 912261893

View in Genome Browser
Species Human (GRCh38)
Location 1:108119172-108119194
Sequence TTGGCAATATCTACATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912261893_912261895 17 Left 912261893 1:108119172-108119194 CCTTCAAATGTAGATATTGCCAA No data
Right 912261895 1:108119212-108119234 TCATAGAATTCTTTTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912261893 Original CRISPR TTGGCAATATCTACATTTGA AGG (reversed) Intergenic
No off target data available for this crispr