ID: 912261895

View in Genome Browser
Species Human (GRCh38)
Location 1:108119212-108119234
Sequence TCATAGAATTCTTTTGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912261893_912261895 17 Left 912261893 1:108119172-108119194 CCTTCAAATGTAGATATTGCCAA No data
Right 912261895 1:108119212-108119234 TCATAGAATTCTTTTGCTGAAGG No data
912261894_912261895 -2 Left 912261894 1:108119191-108119213 CCAAGCTTACAATACTTTGAATC No data
Right 912261895 1:108119212-108119234 TCATAGAATTCTTTTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912261895 Original CRISPR TCATAGAATTCTTTTGCTGA AGG Intergenic