ID: 912265489

View in Genome Browser
Species Human (GRCh38)
Location 1:108152926-108152948
Sequence TATGACATATAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 317}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912265484_912265489 9 Left 912265484 1:108152894-108152916 CCTGAGTAAGTACTAAAGGGCAT 0: 1
1: 0
2: 0
3: 23
4: 127
Right 912265489 1:108152926-108152948 TATGACATATAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 29
4: 317
912265481_912265489 24 Left 912265481 1:108152879-108152901 CCAGAGGAACTAACTCCTGAGTA 0: 1
1: 1
2: 0
3: 13
4: 116
Right 912265489 1:108152926-108152948 TATGACATATAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 29
4: 317
912265480_912265489 25 Left 912265480 1:108152878-108152900 CCCAGAGGAACTAACTCCTGAGT No data
Right 912265489 1:108152926-108152948 TATGACATATAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 29
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912265489 Original CRISPR TATGACATATAGAAAGAGGA AGG Intronic
903074056 1:20748448-20748470 TCTGGCATATAGAAATAGGCCGG + Intronic
904145446 1:28387317-28387339 AGTGACAAATAGAAAGAGGGAGG + Intronic
906005664 1:42467535-42467557 TATGAAATAGAGAAGGAGGAGGG + Intronic
906651506 1:47516127-47516149 TATGACATAGAGCAAAAGGAAGG - Intergenic
906835562 1:49079945-49079967 TAAGACATTTAGAAAAAAGAAGG + Intronic
907865005 1:58390951-58390973 TATAACATATGGGGAGAGGAAGG - Intronic
908918305 1:69158554-69158576 TCTGATATAAAGAAAGAGTAAGG + Intergenic
909542016 1:76802001-76802023 TATGACATATGGTGAAAGGAAGG + Intergenic
911269593 1:95784581-95784603 GGTGACAGAGAGAAAGAGGAGGG - Intergenic
912265489 1:108152926-108152948 TATGACATATAGAAAGAGGAAGG + Intronic
914721833 1:150295550-150295572 TATGATAAATAGAAAGCTGAGGG + Intronic
915755413 1:158255031-158255053 AAAGACATTGAGAAAGAGGATGG - Intronic
918748634 1:188241319-188241341 TATCACATATCAAGAGAGGAAGG - Intergenic
919418231 1:197338223-197338245 TATAAAATATAGAAAGTGTAGGG + Intronic
919488612 1:198175661-198175683 AATGACATATAAAAACATGAGGG + Intronic
919519049 1:198564359-198564381 CCTGACAAATAGAAAAAGGAAGG - Intergenic
919582978 1:199400517-199400539 TATGACAAAGAAAAAGAGGAAGG - Intergenic
919943026 1:202301399-202301421 TATTAAATTTAGAAAGAGGTGGG - Intronic
920877856 1:209854182-209854204 TCTGAAATATAGACAAAGGATGG + Exonic
921321275 1:213941909-213941931 AATGGCATATATAAAGAGGCTGG + Intergenic
922627522 1:227064591-227064613 TATTACCTAGAGAAAGAGGCTGG + Intronic
922707952 1:227800309-227800331 AATGAAAGATAGAAAGAGCAGGG - Intergenic
923694519 1:236234232-236234254 TACTACATAGAAAAAGAGGAAGG - Intronic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
924700989 1:246452115-246452137 TCTAAAATATAGAAAAAGGAAGG + Intronic
924731482 1:246715341-246715363 TTTGACAAATAGAGAGAAGAAGG + Intergenic
1065791083 10:29261598-29261620 CATGAGGTATAGAGAGAGGAGGG - Intergenic
1068121223 10:52783906-52783928 TATGACTAACAGAAAGAGGTGGG + Intergenic
1068272073 10:54741413-54741435 AAGGACATATAGAAAGTGAAAGG + Intronic
1068527468 10:58146882-58146904 TGTCAAATATAGAAAGAGGATGG + Intergenic
1068799293 10:61121359-61121381 TGTGAGACAGAGAAAGAGGAAGG - Intergenic
1069078126 10:64059801-64059823 TAAGATATATTGGAAGAGGATGG + Intergenic
1069384042 10:67868301-67868323 TTTCACATATATAAAGTGGAGGG - Intergenic
1069612931 10:69787376-69787398 TGTGACAGATAGAAGGTGGAGGG + Intergenic
1070427719 10:76305415-76305437 CATGAAAGAAAGAAAGAGGAAGG - Intronic
1070661820 10:78312169-78312191 CAGGACAGATTGAAAGAGGAGGG + Intergenic
1070694149 10:78549397-78549419 AATGGCTTAGAGAAAGAGGAAGG - Intergenic
1070888463 10:79924665-79924687 TATGGCAAATAGAGAAAGGAAGG + Intergenic
1071163755 10:82781153-82781175 TCTGAGATGTGGAAAGAGGAAGG - Intronic
1071165958 10:82806879-82806901 TAGGACAAATAGAAATAGGAAGG - Intronic
1071892604 10:90028042-90028064 TAAGAATTAAAGAAAGAGGAAGG + Intergenic
1073507427 10:104011242-104011264 TAGGACATAAAAATAGAGGATGG + Intronic
1074031333 10:109691607-109691629 GTTAAGATATAGAAAGAGGAAGG + Intergenic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1075681192 10:124333390-124333412 TATTACATATACAAAGAAGCAGG + Intergenic
1077728034 11:4696384-4696406 GATGAGAGAGAGAAAGAGGAGGG - Intronic
1077984040 11:7332538-7332560 TCTGAGATATAGGAAAAGGAAGG + Intronic
1078811837 11:14776020-14776042 TACAAAAAATAGAAAGAGGAAGG + Intronic
1079315864 11:19407405-19407427 GATGACATGTGCAAAGAGGATGG + Intronic
1079502214 11:21114206-21114228 TAAGGGATATAGAAAGAGGTGGG - Intronic
1079546629 11:21641104-21641126 TCTTACATATAGCCAGAGGAGGG - Intergenic
1079777268 11:24547538-24547560 TATTACATATGGTAAAAGGAAGG - Intronic
1079853679 11:25572097-25572119 TATGATGTATAAAAAGAGAAAGG - Intergenic
1080171986 11:29315486-29315508 AATGACATATAAAATTAGGAAGG - Intergenic
1080220544 11:29897921-29897943 TATGGCATATAAAAATAGGTTGG - Intergenic
1081002343 11:37690794-37690816 CATGACATGTAAAAAGTGGAAGG - Intergenic
1081090155 11:38854778-38854800 GATGACATTAAGAAAGTGGAAGG - Intergenic
1082647707 11:55748574-55748596 TTTGACAAATTGAGAGAGGAAGG + Intergenic
1084773443 11:71358958-71358980 GATGATAGATAGAAAGATGATGG - Intergenic
1085364013 11:75920702-75920724 TATGACATATAGAGAGACTATGG - Intronic
1085430823 11:76445840-76445862 TATGACATAAAGAAAAGGGGTGG - Intronic
1085835141 11:79947777-79947799 AATGACATGAAGTAAGAGGAAGG - Intergenic
1086598749 11:88606835-88606857 TAAGACATATAGGAAGAGTGTGG + Intronic
1086698292 11:89869444-89869466 TATAAACTATGGAAAGAGGAAGG - Exonic
1086707872 11:89975044-89975066 TATAAACTATGGAAAGAGGAAGG + Exonic
1086859880 11:91913279-91913301 TATCACATATAGAAATTGAATGG + Intergenic
1086888491 11:92228580-92228602 TATGTCAAATAGAAAGAAGTAGG + Intergenic
1087171742 11:95056564-95056586 TATGAAATACAGAAAGAGGGCGG + Intergenic
1087404654 11:97715901-97715923 TATGATATATACAAAGAGTTAGG - Intergenic
1087423436 11:97962481-97962503 CTTGATATATAGAAAGGGGAAGG - Intergenic
1088548226 11:110983081-110983103 GTTGAAATATAGAAAGTGGAAGG + Intergenic
1089931043 11:122312440-122312462 TAAGACATAAAGAAATAGTATGG + Intergenic
1090303574 11:125670378-125670400 TATTACACATAGAAAAAGCAGGG - Intronic
1090421469 11:126578330-126578352 TATCTCACAAAGAAAGAGGAGGG + Intronic
1090563554 11:127961069-127961091 TATCTCATAAAGAAAGAGGTGGG + Intergenic
1090571725 11:128054523-128054545 TCTGACAAAAAGAAAGAGAAAGG - Intergenic
1091106407 11:132923503-132923525 TGTCATATATAGAAAGAGGTTGG + Intronic
1092551684 12:9509065-9509087 TATCACAAATAGGAAGGGGATGG - Intergenic
1095131797 12:38551249-38551271 TAAGAAAAATAGTAAGAGGAAGG - Intergenic
1095227316 12:39693522-39693544 TATTACATTTAGAATGAGAAAGG - Intronic
1095585729 12:43847337-43847359 TTTGAGGTATAGAAACAGGAAGG + Intronic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1097544555 12:60982726-60982748 TTTGACCCATGGAAAGAGGATGG - Intergenic
1098064240 12:66595326-66595348 TATGACTTTAAGAAAAAGGAAGG + Intronic
1098505360 12:71243148-71243170 TTTCACATGTAAAAAGAGGAGGG - Intronic
1099298625 12:80863141-80863163 TTTGATAGAAAGAAAGAGGAAGG + Intronic
1100162498 12:91876465-91876487 TAAGAGAAATAGAGAGAGGAAGG - Intergenic
1101626265 12:106445110-106445132 GAAGACAAAGAGAAAGAGGAAGG - Intronic
1106009568 13:25806285-25806307 TATGACATATATACAGAAGATGG + Intronic
1106879237 13:34111381-34111403 TATAACATATGGAAAGGGGGTGG - Intergenic
1107169755 13:37326902-37326924 TATGACATAGAGCAAGGCGAAGG + Intergenic
1107754324 13:43603210-43603232 CATGACATATTGAAAGAGCATGG - Intronic
1108095546 13:46897078-46897100 TATGACATACACATAGAGGGAGG - Intergenic
1108419890 13:50237939-50237961 AATGAGATGTAGAAAGGGGATGG + Intronic
1108931857 13:55835116-55835138 TAAGACATCTAAAAAGAGGCTGG + Intergenic
1109420732 13:62107727-62107749 TATCAAATATAGAAAAATGATGG - Intergenic
1111595661 13:90406639-90406661 TATTCCATAAAGAGAGAGGAAGG + Intergenic
1111736988 13:92154127-92154149 TATCACATGGAGAGAGAGGATGG + Intronic
1111919456 13:94395263-94395285 TATGAGATATAGTAAAAGGCAGG + Intronic
1112170277 13:96965869-96965891 AATGAAATCAAGAAAGAGGAGGG - Intergenic
1113186968 13:107698839-107698861 TCTGACAGAAAGAAAAAGGAGGG - Intronic
1114843499 14:26293286-26293308 CATGAAAAATAAAAAGAGGAGGG + Intergenic
1115126431 14:30000101-30000123 TTTGATATATACATAGAGGATGG + Intronic
1115271432 14:31557799-31557821 TGTTCCATATAGGAAGAGGAGGG - Intronic
1116223025 14:42112594-42112616 TATGACATAAAGTGAGAAGAAGG - Intergenic
1116927711 14:50657359-50657381 TAAGACATATGGAAAGAGCTGGG - Intronic
1117762421 14:59044277-59044299 TATGAGATATACAAAGAAGCAGG - Intergenic
1118673413 14:68155874-68155896 TCTTACACATAGACAGAGGAGGG - Intronic
1119570783 14:75669593-75669615 TATGACATATATATAGGGAAAGG + Intronic
1120984608 14:90323313-90323335 TATTACACATAGAGGGAGGAAGG + Intronic
1122324032 14:100872006-100872028 TATGACACATAGGAAGAGGAGGG - Intergenic
1122429789 14:101633110-101633132 CCTGACCTAAAGAAAGAGGAAGG + Intergenic
1125048075 15:35266307-35266329 TATGGTATATATAAACAGGAGGG + Intronic
1125435525 15:39640748-39640770 AATGACATACAGAAATTGGAAGG + Intronic
1125864834 15:43036388-43036410 TATGACTCATAGAAATAGAAGGG - Intronic
1126783449 15:52157824-52157846 TTTGGCAGATAGAAACAGGATGG - Intronic
1128572497 15:68745202-68745224 CATGACAGAAATAAAGAGGAGGG + Intergenic
1131238316 15:90716671-90716693 TATCACACACACAAAGAGGAGGG + Intergenic
1131417617 15:92274289-92274311 TATTCCATATGGTAAGAGGAAGG + Intergenic
1132130184 15:99270017-99270039 TATGACATATATAAAAATGGAGG + Intronic
1135695063 16:24578613-24578635 TATGACATAAAGAAAATGCAGGG - Intergenic
1136071307 16:27789058-27789080 TGTGACACATGGAAGGAGGATGG + Exonic
1137812097 16:51362531-51362553 TTTGACATATAGTATGAGGCAGG + Intergenic
1137827200 16:51509102-51509124 AATTATATATAGAAAGGGGACGG + Intergenic
1138293931 16:55870809-55870831 TATGACCTTAAGAAAGAGAATGG - Intronic
1138673011 16:58630336-58630358 CGTGACATTTCGAAAGAGGAAGG - Intergenic
1138779593 16:59767005-59767027 AATGACATAAAGCAAGAGTAGGG - Intergenic
1138886433 16:61085322-61085344 TTTGGCATATAGGAGGAGGATGG - Intergenic
1140862661 16:79032040-79032062 TATTACATACAGAAGGAGGCAGG - Intronic
1141076391 16:81009612-81009634 TAAGACAAAGATAAAGAGGAAGG - Intronic
1143846433 17:9775698-9775720 TAAGGCATATGGAAAAAGGAAGG + Intronic
1146616276 17:34359644-34359666 GTGGACATATAGGAAGAGGAGGG - Intergenic
1146622870 17:34413542-34413564 GGTGTCATATAGAAAGGGGAGGG + Intergenic
1146627162 17:34443618-34443640 TGTGACAGATTGAAAGAAGATGG - Intergenic
1147367736 17:39970403-39970425 AATGACAGAAGGAAAGAGGAGGG + Intronic
1147873553 17:43604785-43604807 TAAGAATTAAAGAAAGAGGAAGG - Intergenic
1149066559 17:52487727-52487749 TTTGACATGTAGACAAAGGATGG + Intergenic
1149104096 17:52941857-52941879 TATGACATATCCAATGAGAAAGG - Intergenic
1149110557 17:53023394-53023416 TATGAAATACACAAAGAGAAGGG + Intergenic
1150078326 17:62213364-62213386 AAAGAAATAGAGAAAGAGGAAGG - Intergenic
1150598120 17:66625045-66625067 TGTGATCTATAGAAAGATGAAGG - Intronic
1151039672 17:70844056-70844078 TATGACAATCAGAAAGTGGAAGG - Intergenic
1156067849 18:33166651-33166673 TATTACTGATAGAAAGATGATGG - Intronic
1156281167 18:35640238-35640260 AATAACATATTGAAAAAGGAAGG - Intronic
1156953317 18:42931555-42931577 CAAGTCAAATAGAAAGAGGAAGG - Intronic
1156966392 18:43098932-43098954 GATGACATAGAGAAACAGGATGG + Intronic
1157645741 18:49268267-49268289 TATTACATATGGAAAGGGAAGGG + Intronic
1157731842 18:50010937-50010959 TGTGGTATAGAGAAAGAGGATGG - Intronic
1157877993 18:51291565-51291587 TATGAAGGAAAGAAAGAGGAAGG - Intergenic
1157987260 18:52452293-52452315 TATGAAATATAGAGAGAGTAGGG - Intronic
1158943044 18:62424034-62424056 CATGACAAATATAAAGTGGAAGG + Intergenic
1160093060 18:75845287-75845309 GATGATAGATGGAAAGAGGAAGG + Intergenic
1160540580 18:79617999-79618021 TCTGACATAGAAAACGAGGAAGG + Intergenic
1161675530 19:5646191-5646213 GATGACATTTAAAAAGAAGACGG - Intronic
1164304722 19:23995757-23995779 TGTGACAAATGGAGAGAGGAAGG - Intergenic
1167495060 19:49812819-49812841 CAGGTCATATGGAAAGAGGATGG - Intronic
1167932327 19:52876147-52876169 GATGACATAAAGAAAGAAGATGG + Intronic
925829748 2:7882541-7882563 AATGAGAAATAGAAAGAGGCTGG + Intergenic
926023329 2:9516384-9516406 TCTGAAATATACAAAGAGGCCGG - Intronic
926061456 2:9807530-9807552 AATGACATTTATAAAGAGGTAGG - Intergenic
926071629 2:9898603-9898625 AATGACTTACAGAGAGAGGAAGG - Intronic
926385397 2:12330857-12330879 CTTGACATATAAAAAGAGGTGGG + Intergenic
927242535 2:20931318-20931340 TATGAGATGAGGAAAGAGGAGGG - Intergenic
928085416 2:28343351-28343373 TGTGAAATAAAAAAAGAGGAAGG - Intergenic
928645544 2:33348362-33348384 TATTAAATATAGAAAGGTGAAGG + Intronic
929316056 2:40480167-40480189 CATGAAACATTGAAAGAGGAAGG + Intronic
931751834 2:65337679-65337701 TATGTCATAGAGATACAGGAAGG + Intronic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
933131511 2:78678346-78678368 TATGCCATATAGAAATATCAAGG - Intergenic
933325310 2:80828527-80828549 TATCACATATATAAAGATGATGG + Intergenic
933325479 2:80831462-80831484 TAAGAAATAGAGGAAGAGGAGGG - Intergenic
933527194 2:83456638-83456660 TATGACATATGGACATAGGAAGG - Intergenic
933787349 2:85854085-85854107 TTTTTCATAGAGAAAGAGGAAGG - Intronic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935712210 2:105909304-105909326 GAGGACACAGAGAAAGAGGAAGG + Intergenic
936234391 2:110731153-110731175 GATTACATATAGAGAAAGGATGG + Intergenic
936434714 2:112494309-112494331 TATAACAGAAAGAAAGAGGATGG + Exonic
937028789 2:118720966-118720988 TCTGACCTAGAGATAGAGGAAGG - Intergenic
937464123 2:122114956-122114978 TATAACCTAAAGAAAGAGGGAGG - Intergenic
937674383 2:124573349-124573371 AAAGACATAGATAAAGAGGAAGG - Intronic
937722156 2:125113108-125113130 TTTTACATATATAAAGAGTATGG - Intergenic
937880968 2:126864352-126864374 TTTGGTATCTAGAAAGAGGATGG - Intergenic
939384347 2:141476298-141476320 TTTGACAAATAGAAACAAGATGG - Intronic
939733766 2:145818351-145818373 TTTGACAAATATAAAAAGGAAGG + Intergenic
939943519 2:148381125-148381147 TTTGACAAATTGAGAGAGGAAGG + Intronic
940018447 2:149131495-149131517 TATGAGAAAGAAAAAGAGGAGGG + Intronic
947225435 2:227835427-227835449 CATACCATATAGAAAGAGGAAGG - Intergenic
1169923878 20:10762735-10762757 TATGAAATAAAGAGGGAGGAAGG - Intergenic
1170958449 20:21003097-21003119 TATGATAGATAGATAGATGACGG - Intergenic
1171102373 20:22397286-22397308 CATGACATGTTGAAAGAGCATGG - Intergenic
1173216104 20:41085944-41085966 TCTGACCTCTAGAAAGAGGCAGG - Intronic
1173452838 20:43180388-43180410 TATGACAGGGAGAGAGAGGAAGG - Intronic
1174449885 20:50613149-50613171 TAAGAAATAAAGAAACAGGATGG + Intronic
1175372776 20:58503600-58503622 TAAATCATATAGAAAGAGGGAGG - Intronic
1175754120 20:61518548-61518570 GATGACAAATAGAAGGATGATGG - Intronic
1177089348 21:16747700-16747722 TATGAAATATAAAAAGGGAAGGG + Intergenic
1177501584 21:21963839-21963861 GATGAAGTTTAGAAAGAGGAAGG + Intergenic
1178031404 21:28530421-28530443 TATGACATTTTGGAAAAGGAAGG - Intergenic
1178213102 21:30560123-30560145 TATGACATATAGAAATATTCAGG + Intronic
1178750486 21:35297892-35297914 TATGTGAAAGAGAAAGAGGAAGG - Intronic
1181642015 22:24206664-24206686 TAAGAGTTAAAGAAAGAGGAAGG + Intergenic
1184201996 22:42976206-42976228 TGTGACATTTAGAGTGAGGAGGG - Intronic
949761920 3:7480344-7480366 AGTGATATATAGAAAAAGGAAGG + Intronic
951011628 3:17688815-17688837 TGAGAAATATAGAAAGTGGAAGG - Intronic
951143644 3:19198883-19198905 TAGTAAATATAGAAAGAGAATGG + Intronic
952685194 3:36139543-36139565 TATGAGATTCAGCAAGAGGAAGG + Intergenic
953219968 3:40960678-40960700 TATGACATATAGTACTAAGAAGG - Intergenic
953833981 3:46327394-46327416 TTTGTCATATAGAATGATGATGG + Intergenic
954731841 3:52670254-52670276 TATGACATAGAGTGAGAGGTTGG - Intronic
955365996 3:58310634-58310656 TAAGAAATACAGAAAGAGGCCGG + Intronic
956370721 3:68557554-68557576 TATGACAGATAGACAGGTGAGGG - Intergenic
957359582 3:79136295-79136317 TATGACAGAAGGAAAGAAGAAGG - Intronic
957395905 3:79637667-79637689 TAAGATATATATAAAGAGGATGG + Intronic
957490054 3:80912927-80912949 AAAGACAGATAGAAAGAGAAAGG + Intergenic
958449600 3:94257595-94257617 TGTGACATATTGAAACAAGAGGG - Intergenic
959385234 3:105696899-105696921 TATGACAGAAAGAAATAGCATGG - Intronic
960104614 3:113781200-113781222 TTTGAAATATAGAAAGTGGCAGG - Intronic
960233162 3:115252780-115252802 TAGCACATGTAGAAAGTGGAAGG + Intergenic
960373565 3:116870726-116870748 TATGACCTAAAGCAACAGGAGGG - Intronic
960750320 3:120943936-120943958 TTTAACATATTGAAAGATGAGGG + Intronic
962958804 3:140291180-140291202 TAAAACATATAGAAAGAGCCTGG + Intronic
963401985 3:144809631-144809653 TATGACACTTAGAAAGAGAAGGG + Intergenic
964271447 3:154960574-154960596 TATTGCATAGAGAAGGAGGAAGG + Intergenic
965372629 3:167882956-167882978 TATGACCTACAGGAAGAGTATGG - Intergenic
966636205 3:182136549-182136571 TATAACATATACATAAAGGAAGG - Intergenic
969159738 4:5246557-5246579 TATGACAAGTTGAGAGAGGAAGG - Intronic
969323668 4:6428117-6428139 TAGGACATGCATAAAGAGGAAGG - Intronic
970113257 4:12662771-12662793 CATCAAATAGAGAAAGAGGAAGG + Intergenic
970215154 4:13751204-13751226 TATGATATTTAGAAAGAGTAGGG + Intergenic
970785879 4:19795336-19795358 TGTGACATAAAGAAAGAATATGG + Intergenic
971146161 4:23978979-23979001 TATTGCATATAGAAAGAGACAGG + Intergenic
971172073 4:24243582-24243604 CATGGCAAATAGAAAGAGTAGGG + Intergenic
972775416 4:42235323-42235345 TATGAGAGGTAGTAAGAGGAAGG + Intergenic
974160915 4:58137728-58137750 TATGACAAATACAAAGATAATGG - Intergenic
974783325 4:66583633-66583655 TATTACATATAAAAAGAAAAAGG + Intergenic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
978153267 4:105462508-105462530 TATGCTATTTAGAAAGATGAAGG - Intronic
979353288 4:119671461-119671483 TATGTAATAAAGACAGAGGAAGG - Intergenic
979781492 4:124656702-124656724 TTTGAGATATGGTAAGAGGAAGG + Intergenic
979973153 4:127162692-127162714 TATGAAATATAAAATGAGAATGG + Intergenic
981238884 4:142450803-142450825 GGTGACATATAGAAAGAGAAAGG - Intronic
983866536 4:172773800-172773822 TATCAAATATAGAAAAAGCATGG - Intronic
984492130 4:180447772-180447794 TATGATCTATAGAAAGAAGTTGG + Intergenic
986106781 5:4667329-4667351 TATCAAATATAGAGAGATGAAGG + Intergenic
988236198 5:28548500-28548522 TCTGACAGACAGAAAGAAGATGG + Intergenic
988623199 5:32844535-32844557 TGTGAGGTATAGAATGAGGAGGG + Intergenic
988901178 5:35734133-35734155 AATGACATAGGGAAAGAGGGAGG + Intronic
989134943 5:38144454-38144476 AAGGAAATAGAGAAAGAGGAAGG - Intergenic
989333955 5:40292381-40292403 AATGACATTAAGAAAGAGAAGGG + Intergenic
989441163 5:41473921-41473943 TTTGAAATTTAAAAAGAGGAAGG - Intronic
990007441 5:50960510-50960532 AATGAAAGAAAGAAAGAGGAAGG - Intergenic
990172087 5:53062879-53062901 AGTGACCTAAAGAAAGAGGAAGG + Exonic
990249063 5:53894259-53894281 GATGACTTATAGTAAGAGCAAGG - Intronic
991918653 5:71631498-71631520 CATGACATAGGGAAAGAGGATGG + Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
993040690 5:82811112-82811134 TATGACATAGACAAAGAACAAGG - Intergenic
994660581 5:102649044-102649066 TGTGCCAGATAGAAAGAAGAAGG + Intergenic
996668930 5:126093893-126093915 GATTACATCTAGAAAGAGGCAGG + Intergenic
997295625 5:132766615-132766637 TGAGACAGCTAGAAAGAGGAAGG + Intronic
1000254598 5:159525769-159525791 TATCACCTAGAGAAGGAGGAGGG - Intergenic
1002763935 6:223600-223622 TAGGAAATTTAGAAAGAGGGAGG - Intergenic
1002994219 6:2267974-2267996 TATGACCAAAAGAGAGAGGAGGG + Intergenic
1003895094 6:10599847-10599869 CCTGGCACATAGAAAGAGGAAGG + Intronic
1004041244 6:11977872-11977894 AATAACATATAAAAAGAGAAGGG - Intergenic
1004118387 6:12794199-12794221 TATGACTTAAAGGAAGAAGAAGG - Intronic
1004748367 6:18535836-18535858 CATGACATACAGACAGAAGAAGG + Intergenic
1006236604 6:32638777-32638799 AAAGACAGAAAGAAAGAGGAAGG + Intronic
1008209676 6:48705054-48705076 TAAGAAAGAAAGAAAGAGGAAGG + Intergenic
1009268355 6:61586617-61586639 TATGACATTTGTAAAGAGAAAGG + Intergenic
1013503648 6:110777076-110777098 TCTGACATATAGATAGATGCCGG - Intronic
1013848672 6:114486354-114486376 TTTGCCAGATAGAAAAAGGAAGG - Intergenic
1013862463 6:114652264-114652286 TATGAAATATAAATTGAGGAAGG - Intergenic
1014882557 6:126741669-126741691 TGTGACATAATGAAAGAGGTGGG - Intergenic
1015610661 6:135014718-135014740 TAAGACATACAGATAGAGGCCGG + Intronic
1015733351 6:136371111-136371133 GATTAAATAGAGAAAGAGGAAGG + Intronic
1016685944 6:146882375-146882397 TGTGGCATATAGAAAGATGTGGG - Intergenic
1016962626 6:149688178-149688200 TGTGTCATAAAGAAAGAGGAAGG - Intronic
1018438484 6:163785615-163785637 TAGGACATATAGAAGGGGAAAGG + Intergenic
1018492117 6:164304529-164304551 TAGGACATAGAGAAAGAGGGAGG - Intergenic
1019009133 6:168827111-168827133 TATGACATATTTAATGGGGATGG + Intergenic
1020595606 7:10203633-10203655 TGTGAAATATAGCAAGAAGAAGG - Intergenic
1021019464 7:15578571-15578593 AATGATATATAGAAAACGGAAGG + Intergenic
1022841365 7:34167111-34167133 TCTTAGATATAGAAAAAGGACGG - Intergenic
1023376770 7:39564078-39564100 TTTAACATATAGAAAGGAGAGGG - Intergenic
1023660270 7:42463852-42463874 GTTGAGATATAGAAAGAAGATGG + Intergenic
1024724275 7:52175091-52175113 TATGACAGCTAGAAGCAGGAAGG + Intergenic
1025011253 7:55401071-55401093 TATGACATATATAGAGAGAGAGG - Intronic
1026062929 7:67042538-67042560 TGTGACATAGAGAAGGAAGATGG + Intronic
1026344748 7:69464411-69464433 GATGAGAAATAGAAAGAGTAAGG + Intergenic
1026621188 7:71951190-71951212 TATGCCATATAAAAAGAAAAGGG - Intronic
1026646594 7:72176218-72176240 TAAGAATTAAAGAAAGAGGAAGG - Intronic
1026715420 7:72784952-72784974 TGTGACATAGAGAAGGAAGATGG - Intronic
1026848953 7:73712955-73712977 TAGATCATATAGAAAGAGGGAGG - Intronic
1027052931 7:75031128-75031150 TTTGGCATAGAGAAAGAGGAGGG - Intronic
1028340092 7:89707755-89707777 TATGATATATAGAGAGAGCATGG - Intergenic
1029833954 7:103289844-103289866 TAGGACATATTGAAAGAGACTGG + Intergenic
1029848220 7:103435571-103435593 TCTGGCATTTAGAAAGAGGGTGG - Intronic
1031029228 7:116716402-116716424 TATGAAAGAAAGAAAGAGTAAGG + Intronic
1032918395 7:136517973-136517995 TATGATATATAAAGAAAGGAGGG - Intergenic
1033808317 7:144979396-144979418 TAAGGCATAGACAAAGAGGAAGG + Intergenic
1033867146 7:145704707-145704729 GAAGGCAAATAGAAAGAGGATGG - Intergenic
1037387166 8:18355463-18355485 AATCCCAGATAGAAAGAGGAGGG - Intergenic
1037792083 8:21954021-21954043 AGTAACATATAGAAAGAAGAGGG + Intronic
1041671728 8:60498335-60498357 TATAACAACTATAAAGAGGAAGG + Intergenic
1042115582 8:65427498-65427520 TTTGACAAGTAGAGAGAGGAAGG + Intergenic
1042407331 8:68421250-68421272 TCTGAAATCTAGAAAGAAGAAGG + Intronic
1043035108 8:75187223-75187245 CATTACACATTGAAAGAGGACGG - Intergenic
1043773115 8:84229681-84229703 TTTGAGATTAAGAAAGAGGATGG + Intronic
1045194840 8:99920077-99920099 TCTGACAAAGAGGAAGAGGAAGG + Intergenic
1045584196 8:103513025-103513047 TATAAGATATAGAAAGTGGCAGG + Intronic
1045856796 8:106773493-106773515 TATGAATAGTAGAAAGAGGAAGG + Intergenic
1046454042 8:114436089-114436111 TCTGAAATATGGAAAGAAGAAGG + Intergenic
1048797940 8:138168615-138168637 TATGTCATAAAGAAAGAATATGG - Intronic
1050557252 9:6799824-6799846 GATGACATATTGAAAGGGGAGGG - Intronic
1051051435 9:12936977-12936999 TATAATACACAGAAAGAGGATGG - Intergenic
1051138074 9:13946710-13946732 AATGAAATATAGAAAGATGAGGG - Intergenic
1051395425 9:16615210-16615232 TATGACATCTAGGAAGATGTGGG - Intronic
1051773721 9:20610713-20610735 GATAACATATACAAAGAGAAGGG + Intronic
1052648390 9:31268648-31268670 TATGACATATGGGAAGGTGAAGG + Intergenic
1055192209 9:73539130-73539152 TATGAAATATGGAAGGTGGAGGG + Intergenic
1055511049 9:76995903-76995925 TATGACACATACAAATAGGGAGG - Intergenic
1056047701 9:82736258-82736280 AATGAGATAGAGACAGAGGAGGG - Intergenic
1057056725 9:91967756-91967778 TAGCACATATATTAAGAGGATGG + Intergenic
1057079867 9:92165354-92165376 TAAGACATAGAGAAAGGGGAAGG + Intergenic
1058339882 9:103881554-103881576 TGTGAAATACAGAAAGAGAAGGG - Intergenic
1058888791 9:109343347-109343369 TACGGAATATAGAAAGAGCAGGG - Intergenic
1059810455 9:117851044-117851066 TATGAGATTTGAAAAGAGGAAGG + Intergenic
1060909368 9:127337050-127337072 TGTGACATAAAAATAGAGGATGG + Intronic
1061387157 9:130297104-130297126 TTTGACAAAAAGAAAGAAGAAGG - Intronic
1185615752 X:1420793-1420815 TCTGAAAAATAGAAATAGGAAGG - Intronic
1186048590 X:5563984-5564006 TATCACATATAGAGACATGAGGG + Intergenic
1186614643 X:11173842-11173864 TATGAAAGAGAGGAAGAGGAAGG - Intronic
1186702298 X:12104639-12104661 TATGACAAAAACAAAGAGAAGGG - Intergenic
1188145708 X:26610003-26610025 TATGAAAAATGGAAAGAGAATGG + Intergenic
1188484111 X:30663671-30663693 TGTGTGATATAGAAGGAGGAAGG + Intronic
1188642513 X:32523768-32523790 TATGACCTGTATAAGGAGGAAGG + Intronic
1191910790 X:66147225-66147247 TCTGAAAGATAGAAAGAAGAAGG - Intergenic
1193936141 X:87624354-87624376 AATGAAATATATAAAAAGGATGG + Intronic
1194944019 X:100047132-100047154 TAGAACATAAAGACAGAGGAAGG - Intergenic
1194984115 X:100471640-100471662 GATGAGATACAGAAATAGGAAGG + Intergenic
1196112249 X:111959511-111959533 TATGACATATAGAAAACAAATGG + Intronic
1196580062 X:117368523-117368545 TATGTCATTTAGAAATATGAAGG + Intergenic
1197775057 X:130113375-130113397 TATAACACAAAGAAAGAGGCCGG - Intergenic
1198856508 X:141022770-141022792 AAGGACATAAAGAAAGAAGAAGG + Intergenic
1198906184 X:141564597-141564619 AAGGACATAAAGAAAGAAGAAGG - Intergenic
1200977746 Y:9230323-9230345 CATGACATATTGAAAAGGGATGG - Intergenic
1201427393 Y:13867561-13867583 TATGAAATGTAGAAAGAAGCAGG + Intergenic
1202201361 Y:22353859-22353881 TAAGAAATAAAGAGAGAGGAAGG + Intronic