ID: 912267198

View in Genome Browser
Species Human (GRCh38)
Location 1:108170340-108170362
Sequence TTCAACACATTTCAAAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 1, 2: 3, 3: 49, 4: 403}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912267198_912267200 -10 Left 912267198 1:108170340-108170362 CCAGTTCTTTGAAATGTGTTGAA 0: 1
1: 1
2: 3
3: 49
4: 403
Right 912267200 1:108170353-108170375 ATGTGTTGAACCTGGCTTTATGG 0: 1
1: 0
2: 3
3: 26
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912267198 Original CRISPR TTCAACACATTTCAAAGAAC TGG (reversed) Intronic
902291748 1:15440107-15440129 TTCTTCACATTTCACAGAAAGGG + Intronic
904148423 1:28414887-28414909 TTCATCTCATTTCAGAGACCTGG + Intronic
904428173 1:30445073-30445095 TGCAACACATTCCAAAGATTAGG - Intergenic
904920012 1:33999748-33999770 CTCATCATATTTTAAAGAACTGG - Intronic
906812012 1:48836759-48836781 TTCTACTCATTTCTATGAACTGG - Intronic
908644917 1:66266785-66266807 TTTAACAAATATCATAGAACTGG - Intronic
909630328 1:77763837-77763859 TTCAACACTTTTCAAAGCCAAGG + Intergenic
910597670 1:88996685-88996707 CTCAACAAATTGCAAAAAACTGG + Intergenic
911379529 1:97094986-97095008 TTAAACATATTTCAAAGTAAAGG + Intronic
911485016 1:98494513-98494535 TTCAACTCACTTGAAAAAACTGG + Intergenic
911952323 1:104190944-104190966 CTCAACACATTTCAAATTTCAGG - Intergenic
912267198 1:108170340-108170362 TTCAACACATTTCAAAGAACTGG - Intronic
913099595 1:115550939-115550961 TCCAACACATTTCAAGGCAGAGG - Intergenic
913325643 1:117626117-117626139 TTCATCACATTTCAAAGCTTTGG - Exonic
913932738 1:124997954-124997976 TTCAAAACAATTCTATGAACAGG + Intergenic
913964463 1:143363950-143363972 GTCAAAACATTTCAAAGCACTGG + Intergenic
914058832 1:144189556-144189578 GTCAAAACATTTCAAAGCACTGG + Intergenic
914120317 1:144776815-144776837 GTCAAAACATTTCAAAGCACTGG - Intergenic
914854159 1:151338130-151338152 CCCAACACATTTCAAAGAATTGG + Intergenic
915262895 1:154691620-154691642 TTCAACACGTTTTAAAGGAATGG - Intergenic
916644425 1:166768810-166768832 TTCAACTGATTTGAAAGAAATGG + Intergenic
918092013 1:181305230-181305252 TTCAACATTTTTTAAAGTACAGG - Intergenic
918478521 1:184952027-184952049 TTCATCCCGTTTCACAGAACAGG + Intronic
920096473 1:203489571-203489593 TTCAACACACTTCACAGTACAGG + Exonic
921721780 1:218480373-218480395 TTAAAGACATTTCAAAGCACTGG - Intergenic
923132450 1:231088536-231088558 TTCAACAAATTTCAAATGACTGG + Intergenic
923881616 1:238110171-238110193 TTAAACACATTTTCAAGAAAAGG - Intergenic
923927502 1:238649753-238649775 TTCAACCAATTTCAAATAATTGG + Intergenic
1062967527 10:1619814-1619836 ATCAATACATTTAATAGAACTGG + Intronic
1063585440 10:7348281-7348303 TTCAACATATTTCTTAGAAAAGG - Intronic
1063622844 10:7665462-7665484 TTCTCCACATTTCACAGAAGAGG + Intronic
1064293586 10:14057457-14057479 TTCAAGAAATTTCAAGGAAAAGG + Intronic
1065214294 10:23435464-23435486 TTCTAGACATTTCATATAACTGG + Intergenic
1065302048 10:24331736-24331758 TTAAATACATCTGAAAGAACAGG + Intronic
1065329361 10:24578293-24578315 CTCAACAAATTTCAAAGAACTGG + Intergenic
1065495587 10:26324178-26324200 ATCATCACATTTGAAAGAAAGGG + Intergenic
1068378774 10:56219872-56219894 CTCAACACATTTAAAAAAACGGG + Intergenic
1068647390 10:59482595-59482617 TTAACCAGATTTCAAAGAATGGG - Intergenic
1068747476 10:60549821-60549843 TTAAAGCCATTTCACAGAACAGG - Intronic
1068982227 10:63073675-63073697 TTCTACTCATTTCAAAGCTCAGG - Intergenic
1069852165 10:71415870-71415892 CTCAAAACATGTCAAAGAACTGG - Intronic
1070352163 10:75603012-75603034 TTCAATACATTTGAAATAGCAGG - Intronic
1070722632 10:78767366-78767388 TTCAACCCATTTCATAGATATGG + Intergenic
1071145178 10:82561341-82561363 TTCAATACATTTTAAAGGCCAGG - Intronic
1071742295 10:88373632-88373654 TTTAAAACATTGCAAAGAAATGG - Intronic
1072634689 10:97170300-97170322 CTCACCACATTTCCAAGAAGTGG - Intronic
1072866260 10:99065514-99065536 TTCAACTCATATCAAATACCTGG - Intronic
1073517749 10:104092719-104092741 TAACACAAATTTCAAAGAACTGG - Intergenic
1073960012 10:108914750-108914772 CTCAACAAACTTCAATGAACAGG + Intergenic
1074030237 10:109680016-109680038 ATCACCACATTTCAAAGATCAGG + Intergenic
1074561134 10:114536156-114536178 TTCCACACATTTCATACAAATGG + Intronic
1074685028 10:115953728-115953750 CTCAACACAGTTAAATGAACAGG - Intergenic
1074765625 10:116697896-116697918 TTCTGGACATTTCATAGAACTGG + Intronic
1074815646 10:117139634-117139656 TTCCACACAATTCCAAGAATGGG + Intergenic
1075164048 10:120051132-120051154 TTCAAAACAATTCAAAAAATGGG - Intergenic
1075600533 10:123765105-123765127 CTCAACAAATTTCAGAGAATAGG - Intronic
1076262813 10:129081970-129081992 CTCAACAAATTTCAGAGGACTGG + Intergenic
1077667515 11:4127006-4127028 GTCAACAGATTTTAAAGAAAAGG - Intronic
1078819175 11:14859540-14859562 TTAAACTCATTTGAAATAACTGG - Intronic
1078824070 11:14910197-14910219 CTCAATAAATTTCCAAGAACTGG - Intronic
1079525371 11:21380764-21380786 TTCAAGTCATTTCAATTAACTGG + Intronic
1079860822 11:25669206-25669228 CTCAGAAAATTTCAAAGAACAGG - Intergenic
1080751860 11:35158040-35158062 TTCCAAACAATACAAAGAACAGG - Intronic
1080983686 11:37435730-37435752 TTTAAGAAATATCAAAGAACGGG - Intergenic
1083710850 11:64547397-64547419 TTCAATACATTTTAAAGAGGTGG - Intergenic
1085727887 11:78970346-78970368 TTGAAAGCATTTCAAAGAGCTGG + Intronic
1086776416 11:90840027-90840049 TTCAACAAATTTGAAATGACTGG + Intergenic
1086823782 11:91470245-91470267 TGCAGGAAATTTCAAAGAACAGG - Intergenic
1087559887 11:99774702-99774724 TTCAAAACATTTGAAGTAACAGG - Intronic
1088234614 11:107709097-107709119 TTGTAAACATTTCAAAGAGCAGG + Intronic
1088544686 11:110947523-110947545 CTCAACCCATTTGAAAGAAAAGG + Intergenic
1089095559 11:115917397-115917419 TTCAAGCTTTTTCAAAGAACAGG - Intergenic
1089795176 11:120974538-120974560 TTCGAGAAATTTCAAAGAAAAGG + Intronic
1090292998 11:125562608-125562630 TTGAACACAGTTCAAACAATTGG - Intergenic
1090677314 11:129011630-129011652 TTCAAAACATTTTAAAACACTGG + Intronic
1090899224 11:131012118-131012140 CTCAACAAACTTCAAGGAACTGG - Intergenic
1090930433 11:131293121-131293143 TTCATAACAGTTCAAAGCACAGG + Intergenic
1092753022 12:11736683-11736705 TTAAACACAAGTCACAGAACTGG + Intronic
1093135549 12:15445836-15445858 TTCCAGACATGTCAAAGACCTGG - Intronic
1093351618 12:18109299-18109321 TTCAAAACATATAAAAGGACTGG + Intronic
1093598540 12:20992288-20992310 TTCAACAAATTTCAAAAAGTAGG - Intergenic
1093654156 12:21675721-21675743 TGCAAAACATATCAAAGAATAGG - Intronic
1095747830 12:45679080-45679102 TTCATCACGTTACCAAGAACTGG + Intergenic
1097303727 12:58046215-58046237 TTCAAAACTTTTCAAAGTTCTGG + Intergenic
1098156919 12:67608930-67608952 TGCCACACTTTTCATAGAACTGG + Intergenic
1098161679 12:67651321-67651343 ATCAACACATAGCAAAAAACTGG - Intronic
1098417026 12:70245146-70245168 TATAAAACATTTCAATGAACTGG - Intronic
1099321241 12:81152271-81152293 TTCAACAAAATTTAAATAACAGG - Intronic
1099351624 12:81577486-81577508 TTCAAAACAATTCAAAGAAGAGG + Intronic
1099542534 12:83930561-83930583 TGCAGCACATTTTAAATAACAGG + Intergenic
1099902751 12:88732987-88733009 CTAAAAACATTTCAAAGATCTGG + Intergenic
1101118634 12:101556074-101556096 TTCAACAAATTTGGAAGGACAGG + Intergenic
1101221464 12:102645643-102645665 TTCAACACTTTTTATAAAACAGG + Intergenic
1101470225 12:104989249-104989271 TTAAACACATTTAAAAAATCAGG + Intronic
1101831890 12:108264158-108264180 TTAAACACTTTGCACAGAACTGG - Intergenic
1101855661 12:108440704-108440726 TTCAAAATATGTCAAAGAAATGG - Intergenic
1102059561 12:109922506-109922528 TTCTCCACATTTCACAGAACTGG - Intronic
1106474127 13:30082749-30082771 TTCAACAATTTTCAAATAGCAGG - Intergenic
1106742996 13:32667112-32667134 TTAAACATATTCCAGAGAACAGG - Intronic
1106743007 13:32667283-32667305 TCAAACACATTTCAGAGCACAGG - Intronic
1106933587 13:34693728-34693750 TTCATCACATTTCAAAAGACTGG + Intergenic
1107106662 13:36650431-36650453 TTCAGCACATTTCAAAGCAGAGG + Intergenic
1108167448 13:47708359-47708381 TTCAAGACATTTCAGTAAACTGG - Intergenic
1108317054 13:49247359-49247381 CTGAACAAATTTCAAAGAACTGG + Intergenic
1108920454 13:55667050-55667072 TTGAACACATTTCAGGAAACAGG - Intergenic
1110285694 13:73747885-73747907 TTCAAGACATGTCACAGAATGGG + Intronic
1110644872 13:77870724-77870746 TTCAAGACATTGCTAAGAAGTGG + Intergenic
1110763667 13:79257661-79257683 CTCAACAGATCTCAAAGAATTGG - Intergenic
1111406606 13:87814556-87814578 ATAAACACATGTCAAGGAACGGG + Intergenic
1111523031 13:89429639-89429661 TCCAACACATTTCAAAGGAAAGG - Intergenic
1111762563 13:92483970-92483992 TACAAAACATTTAAAATAACTGG + Intronic
1111766349 13:92535041-92535063 TTCATTAAATTGCAAAGAACGGG + Intronic
1111842885 13:93472700-93472722 CTCAACACATTGCAAAGAGAAGG - Intronic
1113236333 13:108279096-108279118 TTTAACACATTTCATAAAGCTGG + Intronic
1113627238 13:111856359-111856381 TTGAACGCATTACAAAGCACAGG + Intergenic
1115315951 14:32025337-32025359 TTAAATGCATTTCAAAGAAAGGG + Intergenic
1115753075 14:36509281-36509303 TTCAATACATTTTAAACAAGAGG - Intronic
1116047248 14:39759446-39759468 TAAAACACATATCAGAGAACTGG - Intergenic
1116259784 14:42609897-42609919 TTAAGAACATTTCAGAGAACTGG - Intergenic
1116623509 14:47236941-47236963 TTGATAACATTTCTAAGAACTGG - Intronic
1117974512 14:61283884-61283906 TTCCACACATTTCTAAAAACAGG - Intronic
1118833205 14:69454656-69454678 TTGAACACATTTTAAAGATAAGG + Intronic
1119404901 14:74392180-74392202 TTCAACACTATTCCAAGAACAGG - Intergenic
1119429822 14:74559277-74559299 GTCAACACATTTTTAACAACCGG + Intronic
1120076852 14:80168506-80168528 TGTAACAGATTTCAAAGATCTGG + Intergenic
1120700469 14:87693547-87693569 TTCAAGGCATTTTACAGAACTGG + Intergenic
1120748662 14:88177050-88177072 TTAAATATATTTCTAAGAACAGG + Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1123451340 15:20363490-20363512 TTCTCCAAATTTTAAAGAACAGG + Intergenic
1123471164 15:20553480-20553502 CTCAACAAATTCCAAAGAAGCGG + Intergenic
1123646895 15:22447221-22447243 CTCAACAAATTCCAAAGAAGCGG - Intergenic
1123731464 15:23148474-23148496 CTCAACAAATTCCAAAGAAGCGG + Intergenic
1123749602 15:23345886-23345908 CTCAACAAATTCCAAAGAAGCGG + Intergenic
1123909630 15:24954724-24954746 TTTTACACATTTTAAAAAACAGG + Intronic
1124281975 15:28369761-28369783 CTCAACAAATTCCAAAGAAGCGG + Intergenic
1124300727 15:28541838-28541860 CTCAACAAATTCCAAAGAAGCGG - Intergenic
1125090416 15:35784462-35784484 TCCAACAAATTGCAGAGAACTGG - Intergenic
1125778110 15:42236834-42236856 TTCAAGACCTTTCAAAGACCAGG + Intronic
1126508503 15:49437939-49437961 TTAACCACATCTCAAAGAGCAGG + Intronic
1127010105 15:54615899-54615921 TTGAACACATTTCAATAAAGGGG - Intronic
1127688855 15:61375114-61375136 TTCTGGACATTTCAAATAACTGG + Intergenic
1127736649 15:61846818-61846840 TCCAACACATTTCAGATGACAGG + Intergenic
1128777318 15:70330814-70330836 TGCAACAAATATCAAACAACTGG - Intergenic
1129020853 15:72516441-72516463 TACATCACATTTCTAAGAGCTGG + Intronic
1129683208 15:77670120-77670142 TTCTAGACATTTCATAGAAATGG - Intronic
1130187252 15:81696250-81696272 TTCAACAAAATACAAAGAACTGG + Intergenic
1130726812 15:86447771-86447793 TTCAGAAAATCTCAAAGAACTGG - Intronic
1130787753 15:87118953-87118975 TTAAACACATTTCAAACACATGG - Intergenic
1131272378 15:90955151-90955173 TTCAGCCCATTTCACAGACCGGG + Intronic
1131767562 15:95696067-95696089 TTCCACACATTACAAAGTATAGG + Intergenic
1132650130 16:1017268-1017290 TTCAAGACATTTCACATAAATGG + Intergenic
1133490475 16:6263119-6263141 TTCAACCCATTTCAACCCACAGG - Intronic
1133527539 16:6620418-6620440 AACAACACAATTAAAAGAACTGG + Intronic
1134387063 16:13783324-13783346 TTACACATATTTCAAAGGACAGG + Intergenic
1136686835 16:32000175-32000197 CTCAACACCTATGAAAGAACAGG - Intergenic
1136787448 16:32943717-32943739 CTCAACACCTATGAAAGAACAGG - Intergenic
1136882332 16:33910067-33910089 CTCAACACCTATGAAAGAACAGG + Intergenic
1137266934 16:46876686-46876708 TTGATAACATTTCAAAGCACTGG - Intergenic
1137337825 16:47568112-47568134 TACCAGACATTTCAAATAACTGG - Intronic
1137966620 16:52940577-52940599 TTTAATACTTTTCAAAGAACTGG + Intergenic
1138230706 16:55333779-55333801 GTCAGCACATTTAAAAGAGCTGG - Intergenic
1140585337 16:76284322-76284344 TTTAACAGATTTTCAAGAACAGG + Intronic
1140731598 16:77861577-77861599 TGCAACACAGGTCAAAGACCTGG - Intronic
1203089677 16_KI270728v1_random:1205389-1205411 CTCAACACCTATGAAAGAACAGG - Intergenic
1144110405 17:12025728-12025750 TTCATTACATTTTAAAGTACTGG - Intronic
1144287311 17:13789442-13789464 TTCAACACAATTCCATAAACTGG - Intergenic
1146317182 17:31816799-31816821 CTCAACAAATTTCAAAGGACTGG + Intergenic
1148452167 17:47786211-47786233 TACAACAAACTTCACAGAACAGG + Intergenic
1148519980 17:48264359-48264381 TTAAATGGATTTCAAAGAACTGG - Intronic
1149598707 17:57879495-57879517 CTCAGTATATTTCAAAGAACAGG - Intronic
1149670541 17:58404615-58404637 ATCAACACATTTTAGGGAACAGG + Intronic
1149787551 17:59449027-59449049 TTCTAGACATTTCAGAGAAATGG - Intergenic
1149929630 17:60738083-60738105 CTTAACAAATTTAAAAGAACAGG - Intronic
1150632797 17:66891954-66891976 TTAAACAAATTTCAGAGATCTGG - Intergenic
1150675329 17:67241307-67241329 TTCTATACATTTGAAACAACAGG + Intronic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1153611343 18:6888731-6888753 TTCAATACATTTCTAACAAAAGG + Intronic
1154983717 18:21527671-21527693 TTCAACACTTTTCACACAAACGG + Intergenic
1155304881 18:24469333-24469355 CTCATCACATTTCAAAGTATGGG - Intronic
1155509892 18:26566103-26566125 TTCAACTCAGTTCAACAAACTGG - Intronic
1156942226 18:42782055-42782077 TTCAATATCTTTCAAAGCACAGG + Intronic
1158135086 18:54199142-54199164 TTTAAAACATTTGAAAGAACAGG + Intronic
1158815919 18:61096752-61096774 ATCAATAAATTTCATAGAACTGG + Intergenic
1158852017 18:61504104-61504126 TACAGCACATTTGAAAGAGCAGG - Intronic
1159301137 18:66570377-66570399 TTAAACACATTTCAATCAAATGG + Intronic
1159454839 18:68648189-68648211 TACAACACATGGTAAAGAACTGG + Intergenic
1159539126 18:69753093-69753115 TTGAACACATTTCATTGAAAAGG - Intronic
1159560974 18:69994034-69994056 CTCAATACATTCCAAAGAATAGG - Intergenic
1159561883 18:70004181-70004203 TTCAAGACATTTCAAATAATAGG + Exonic
1159999843 18:75006632-75006654 TACAACAAATTTCAAAGAACTGG - Intronic
1160075382 18:75670133-75670155 ATATACATATTTCAAAGAACTGG + Intergenic
1161148941 19:2696733-2696755 TCCTAGACATTTCAAAGAAATGG - Intronic
1161402224 19:4071914-4071936 TTCAGCACATTTCAGAGAAATGG - Intergenic
1161916113 19:7229466-7229488 CACAAAACATTTCTAAGAACAGG + Intronic
1168150871 19:54447914-54447936 TTCAAAACGTTGCAAAGACCGGG - Intergenic
1202698235 1_KI270712v1_random:141441-141463 GTCAAAACATTTCAAAGCACTGG + Intergenic
925036133 2:687415-687437 ATCAACTGATATCAAAGAACGGG - Intergenic
925948264 2:8886668-8886690 TTAAATCCATTTAAAAGAACAGG + Intronic
926485637 2:13452794-13452816 TTCTCCAAATTTTAAAGAACAGG - Intergenic
926872975 2:17443442-17443464 TTTAACTCATTTGAAAGTACTGG + Intergenic
927750043 2:25660349-25660371 TTCTGGACATTTCATAGAACTGG - Intronic
928748042 2:34438171-34438193 TTCAAGAATTTTCAAAGAATTGG + Intergenic
928812243 2:35242622-35242644 CCCAACACATTTAAAAGAATTGG + Intergenic
928816658 2:35304006-35304028 TTCAACAAATTCCAAACAAGTGG + Intergenic
928925905 2:36579339-36579361 TTCAACAAAATTCACAGATCAGG - Intronic
929433082 2:41905168-41905190 TTAAAGACATATCAAATAACTGG - Intergenic
930387235 2:50712209-50712231 TTCAACACATTATAAACATCAGG + Intronic
931663229 2:64589269-64589291 TTCAACAGTTTTCAGACAACTGG - Intronic
931854235 2:66284953-66284975 TTCAACACATAGCCTAGAACAGG + Intergenic
932924076 2:75950672-75950694 TTCATTACATTTTAAAGGACTGG - Intergenic
933008490 2:77025474-77025496 TGCAACACATTTCTTAGAAATGG + Intronic
934279487 2:91599224-91599246 GTCAAAACATTTCAAAGCACTGG + Intergenic
935048771 2:99506000-99506022 TTGAACACAGTTCAAACAGCTGG - Intergenic
935516473 2:104046777-104046799 TTCAACAGAGTTCAAAGCAGGGG - Intergenic
935733604 2:106087581-106087603 TTCAACACATTTAAAAGAACTGG - Intergenic
936806854 2:116344264-116344286 TTGGACACAATTCAAAAAACAGG - Intergenic
937219607 2:120334698-120334720 TTTAACAAATTTCATAGCACTGG + Intergenic
937334528 2:121053873-121053895 TTCCACACACTTTAAACAACAGG - Intergenic
938745065 2:134269937-134269959 TTAAACACTTTTTAAAAAACTGG + Intronic
939314753 2:140533569-140533591 TGGAAGATATTTCAAAGAACTGG + Intronic
940344764 2:152617772-152617794 TTCAGCACAATTCCAAGCACAGG - Intronic
940553347 2:155190477-155190499 TTTGACCCATGTCAAAGAACAGG + Intergenic
941258562 2:163266591-163266613 TTCTAGACATTTTAAATAACTGG + Intergenic
941842678 2:170104189-170104211 TTTAACAAATTGGAAAGAACTGG - Intergenic
943337307 2:186632367-186632389 TTAAACACATTTCTGAGAAAAGG + Intronic
943537652 2:189172345-189172367 TTCAAAACAATTCAAAGATTTGG + Intronic
943901833 2:193448897-193448919 TTCAGCATTTTTCAAAGAAATGG + Intergenic
944939949 2:204613363-204613385 ATCATGAAATTTCAAAGAACTGG - Intronic
946652041 2:221902627-221902649 CTCAACATATTTCAATGTACTGG + Intergenic
947468606 2:230378666-230378688 TTTAACACATTTTAAATAATTGG - Intronic
1169231916 20:3895510-3895532 CTCAAAACATTTCAAAAAATAGG + Intronic
1169630637 20:7626747-7626769 CTCAAGACATTTCTAAGAATTGG - Intergenic
1169703017 20:8469996-8470018 TTCCAGACATTTCATAGAAATGG + Intronic
1169881291 20:10350318-10350340 TTCACCACAAGTCAAAGTACAGG + Intergenic
1170134237 20:13055490-13055512 ATCAGCACATTTCAGAGCACAGG + Intronic
1171749345 20:29032853-29032875 TTCAAGGCATTGCAAACAACTGG - Intergenic
1172216169 20:33237396-33237418 TCCACCACATTCCAAAGAAGAGG - Intronic
1172566526 20:35934857-35934879 TTCCTCACATTTCATAAAACAGG + Intronic
1172777066 20:37413943-37413965 TTCCTCTCATTTCAAAGAATTGG + Intergenic
1172857094 20:38013546-38013568 TTCAACATGTGTGAAAGAACAGG - Exonic
1173668762 20:44782742-44782764 TTCAAAACTTTTAAAAGAAAAGG + Intronic
1175288303 20:57853227-57853249 CTCAATATATTTCAAAGGACTGG - Intergenic
1175455088 20:59106477-59106499 TTCAACTCAATTCACAAAACAGG + Intergenic
1176315831 21:5242835-5242857 TTCAAGGCATTGCAAACAACTGG + Intergenic
1176885863 21:14255205-14255227 TTCAACTCATTTAAAAAAATTGG + Intergenic
1177274835 21:18896513-18896535 TTCCACCCCTTTCTAAGAACTGG - Intergenic
1177951787 21:27547157-27547179 TGGAACCCATTTCAGAGAACTGG - Intergenic
1178021800 21:28416765-28416787 TTTAACATATTTCTAAAAACTGG + Intergenic
1178155069 21:29843503-29843525 TTCAACAAATTTCAAAATATTGG - Intronic
1180393630 22:12308780-12308802 TTCAAGGCATTGCAAAAAACTGG + Intergenic
1180406119 22:12555972-12555994 TTCAAGGCATTGCAAAAAACTGG - Intergenic
1180925502 22:19551093-19551115 TTCTGGACATTTCATAGAACTGG + Intergenic
1180925509 22:19551173-19551195 TTCTGGACATTTCATAGAACCGG + Intergenic
1180925518 22:19551253-19551275 TTCTGGACATTTCATAGAACCGG + Intergenic
1181520489 22:23446590-23446612 TTCCACACATTTCAGAAAATTGG + Intergenic
1181655979 22:24299267-24299289 TTCAATAGTTTTTAAAGAACGGG + Intronic
1182635699 22:31725088-31725110 TTCAACACACTCAAAAGAAAGGG + Intronic
1183235489 22:36613923-36613945 TTCAAGACATGTTAAAGAATTGG - Intronic
949244685 3:1912994-1913016 TTCCTCACATGTCTAAGAACTGG + Intergenic
950940626 3:16886925-16886947 TTCAAAACAATTAAAAGAAAGGG - Intronic
951085469 3:18507929-18507951 TTACACACACTTCAAAGAAGAGG + Intergenic
951626039 3:24664132-24664154 TTCAACACATTTCAGAATATTGG - Intergenic
952442537 3:33346659-33346681 TACTGAACATTTCAAAGAACTGG - Intronic
952579810 3:34819650-34819672 TTCAACAAATTTAAAAGAAATGG - Intergenic
952926166 3:38320894-38320916 TTCAAAACATTTTTAAGAATAGG - Intergenic
953100568 3:39821804-39821826 ATCAACAAATTTCAAATAACTGG - Intronic
953304466 3:41814399-41814421 CTCAACAAATTCCAAAGAAGTGG - Intronic
955931487 3:64061856-64061878 TCCAACAGCATTCAAAGAACTGG - Intergenic
957124696 3:76143738-76143760 ATCAATACATTTTAAAGGACTGG + Intronic
957167767 3:76697144-76697166 TTGAACACATTTGATAGATCTGG - Intronic
957342718 3:78921753-78921775 CACAACACATATAAAAGAACAGG + Intronic
959551232 3:107660988-107661010 TTCAACACATTTCAGCTGACTGG - Intronic
961483869 3:127203429-127203451 ATCTATAAATTTCAAAGAACTGG - Intergenic
961954207 3:130784104-130784126 TTCTGAACATTTCAAAGACCGGG + Intergenic
962811721 3:138964093-138964115 TTCAACAAATTTTATTGAACTGG - Intergenic
963221208 3:142814385-142814407 TCCAACAAATTTCAAACAACTGG - Intergenic
964711167 3:159673430-159673452 ATCAACACATTCCAAAGCAATGG - Intronic
965834992 3:172841299-172841321 TTAAACACATTTCTAAGAGATGG - Intergenic
965858830 3:173122597-173122619 TTTAAAACATTTAAAAGAACTGG - Intronic
965904313 3:173684579-173684601 TTCAACACATTTTAAAAATTGGG - Intronic
966477820 3:180370122-180370144 TTCAGCAAATGTAAAAGAACAGG + Intergenic
966845443 3:184125573-184125595 CTCAACAGATTTCAAGGAATTGG - Intergenic
967576988 3:191106076-191106098 TTCAACAAATGTCAAAAGACTGG + Intergenic
967759970 3:193212814-193212836 TTCCACACCTTTCCAAAAACTGG + Intergenic
969031265 4:4216672-4216694 GTCAGAACATTTCAAAGCACTGG - Intronic
969970141 4:11038378-11038400 TTCAAGACATATAAAATAACTGG + Intergenic
970873123 4:20839615-20839637 TACAACACAATTCAGAGTACTGG + Intronic
971186355 4:24380850-24380872 TTCTACACATCTCAAATCACTGG - Intergenic
971937766 4:33174892-33174914 TTCAACACATTTTTTAGCACTGG - Intergenic
972359669 4:38315378-38315400 TGCAACACATTTTAAAGCAGAGG + Intergenic
972886054 4:43489556-43489578 ATCAAAAAATTTTAAAGAACTGG - Intergenic
973148596 4:46860549-46860571 TTCACCAGATGTCAAAGAAGGGG - Intronic
973553377 4:52057474-52057496 TTAAACACATCTTAAATAACAGG - Intronic
974567744 4:63599852-63599874 ATCAGCAAATTTCAAAGAAAAGG + Intergenic
974904815 4:68042220-68042242 TTCACAAAATTTAAAAGAACAGG - Intergenic
975240554 4:72052613-72052635 TTCAAAATATCTCAAAGAATAGG - Intronic
975773995 4:77763762-77763784 ATCAACAAATGTCACAGAACTGG + Intronic
976138951 4:81970420-81970442 TTCAACACTGTTCTAAAAACAGG - Intronic
976871464 4:89798877-89798899 TTTAACAAATTAAAAAGAACCGG + Intronic
977059990 4:92246037-92246059 TACACCAGATTTCAAAGAATTGG + Intergenic
977111365 4:92960142-92960164 TTTAACAAATTTGAAAGAATAGG - Intronic
977255916 4:94739905-94739927 ATTAATGCATTTCAAAGAACGGG - Intergenic
978266036 4:106825610-106825632 TTCGCCAAATTTCAAAGAAATGG + Intergenic
978697556 4:111600464-111600486 TCCAACACATCCCAAAGAAAGGG - Intergenic
979000387 4:115210023-115210045 TTCAACAGTTTTGGAAGAACAGG - Intergenic
979437967 4:120716970-120716992 GTCAACACAGTTAGAAGAACAGG + Intronic
980224847 4:129969319-129969341 TTAAACACTTTTCAAAAAAAGGG + Intergenic
980431982 4:132713107-132713129 TTGAACACATTCTAAAGATCAGG + Intergenic
980501937 4:133667659-133667681 TAAAATATATTTCAAAGAACTGG - Intergenic
980692735 4:136317184-136317206 TTGAACACAGTTCAAACAATTGG - Intergenic
981428680 4:144634942-144634964 TTCAACACATTTCTAGAAAGTGG + Intergenic
984380326 4:178984862-178984884 TACAATGTATTTCAAAGAACTGG + Intergenic
984746777 4:183228546-183228568 TTCAATATATTTCAAAGTATTGG + Intronic
985431281 4:189882739-189882761 TTCAAGGCATTGCAAACAACTGG - Intergenic
985766211 5:1780885-1780907 TTGAACACAGTTCAAACAGCTGG + Intergenic
986612205 5:9580466-9580488 ATCAGTACATTTCAAAGAAGAGG - Intergenic
986843860 5:11730396-11730418 TTCAATTCATTACAAAGAAGAGG - Intronic
987481407 5:18463392-18463414 ATCAACACAATTGAAATAACGGG + Intergenic
987813172 5:22865800-22865822 TTCTACACATCTAAAATAACTGG - Intergenic
988294674 5:29340798-29340820 TTCTACACGTTTCAAATAAATGG - Intergenic
988306469 5:29499819-29499841 TTCTACATATTTCCAAGAACAGG - Intergenic
989826314 5:45860576-45860598 TTCTAAACATTTCATAGAAATGG + Intergenic
990926363 5:61029587-61029609 TTCAAAAAATTTCAGAGCACAGG - Intronic
991268443 5:64750032-64750054 TTCAAAAAATTTCAATGAATGGG - Intronic
991288877 5:65011506-65011528 TTCAGGAAACTTCAAAGAACTGG + Intronic
991317556 5:65326542-65326564 TTCTACACAATTTAAAGAAAGGG + Intronic
992053206 5:72960320-72960342 TTCAAAACCTTTTACAGAACAGG + Intronic
993080833 5:83298171-83298193 TTCAACAAACTTCAAAGGACTGG - Intronic
993223867 5:85140027-85140049 TTCATCACATTACTCAGAACAGG + Intergenic
993879269 5:93343929-93343951 TTTAAAACAATTCTAAGAACTGG + Intergenic
994196303 5:96926555-96926577 TACAATACATTTCAAATAAGTGG + Intronic
994446611 5:99882314-99882336 TTCAACAAGTTTTAAAGAATAGG - Intergenic
995286184 5:110390903-110390925 GTTAACAAGTTTCAAAGAACTGG + Intronic
995554855 5:113317054-113317076 TTCATCAGATTTCACAAAACTGG + Intronic
996049285 5:118913743-118913765 TTAAACACAATTTAAATAACTGG + Intronic
996303774 5:122022364-122022386 TTTTAGAAATTTCAAAGAACAGG + Exonic
996608217 5:125348737-125348759 GTCAACACATTTCAAACAAGAGG - Intergenic
996766486 5:127039533-127039555 TTCAAGACATTTCATATAAATGG - Intergenic
996945477 5:129061996-129062018 TTCATAACATTGCAAAGAAAGGG - Intergenic
997450159 5:133976159-133976181 TTCACCAAATTTCACAAAACAGG + Intronic
997637258 5:135421723-135421745 TTAAACAGATTTCAAAAAACTGG - Intergenic
1000643777 5:163736979-163737001 TTCATCACCTTTGAAAGACCTGG - Intergenic
1001352004 5:170977765-170977787 TTCCAGACATTTCAAACCACTGG - Intronic
1002389005 5:178894959-178894981 CTCAACACATTTCAAGCAATTGG - Intergenic
1003211716 6:4074155-4074177 TTCAAGACATTTTAAAGGACAGG + Intronic
1003721145 6:8703656-8703678 CTGAAAACATTTGAAAGAACAGG + Intergenic
1004845906 6:19641555-19641577 AGGAACTCATTTCAAAGAACTGG + Intergenic
1005062841 6:21793131-21793153 GTAAACACACTTCAAAGAAAAGG + Intergenic
1005913842 6:30334529-30334551 TTCAAGTCACTTCAGAGAACTGG - Intronic
1009335334 6:62481991-62482013 GTGAACAAATTCCAAAGAACAGG - Intergenic
1009480117 6:64146604-64146626 TCCTACACTTTTCAAAGTACTGG - Intronic
1009746011 6:67816809-67816831 TTCAAAACATATCACAGAAAAGG - Intergenic
1009748388 6:67850094-67850116 TCTAACACATCTTAAAGAACTGG + Intergenic
1010439594 6:75877733-75877755 TTCTAAACATTTCCATGAACTGG - Intronic
1010671464 6:78691717-78691739 TTATACCCATTTTAAAGAACTGG - Intergenic
1010879167 6:81147012-81147034 TTGAACACATTATATAGAACTGG + Intergenic
1011793177 6:90921500-90921522 GTCAACACATTTCGAAGTACTGG + Intergenic
1011903150 6:92326093-92326115 CTCAGGACATTTTAAAGAACAGG - Intergenic
1012480233 6:99658764-99658786 TTCATAACATTTCAGAGAAATGG - Intergenic
1012826678 6:104154821-104154843 TTTAACATATTTCAAAGAAAAGG - Intergenic
1013426030 6:110013371-110013393 TTCAACACTTTTCCCAGGACAGG + Intergenic
1013579723 6:111521388-111521410 TTCAAAAAATTTAAAAGAATTGG - Intergenic
1015019022 6:128449162-128449184 TTAAACACATTTTATAAAACTGG - Intronic
1015035334 6:128646344-128646366 GTCCACACATTTTAAACAACAGG - Intergenic
1015104190 6:129517390-129517412 TTCAGAACATGTAAAAGAACAGG + Intergenic
1016075565 6:139791416-139791438 TTATTGACATTTCAAAGAACCGG + Intergenic
1016141975 6:140624131-140624153 TCCAACACATTTGATATAACAGG + Intergenic
1016566010 6:145454840-145454862 TTCAACACATTGCAACGGATTGG + Intergenic
1017396543 6:154006700-154006722 TTCAAAAAAATTCAAAAAACTGG + Intergenic
1017621794 6:156306847-156306869 TTCTCCTCATTTCACAGAACTGG + Intergenic
1017998770 6:159559677-159559699 TTCAACACATTTAAAATAATTGG + Intergenic
1018230572 6:161671217-161671239 TTCAACACATCTCTAAGAATAGG + Intronic
1018474359 6:164124963-164124985 GTCAACACATTCTAAAGAAAGGG - Intergenic
1018963043 6:168462232-168462254 TTCATTACACTTCACAGAACTGG - Intronic
1019403419 7:869078-869100 TACAACATACTTCAAAGAAAAGG - Intronic
1019590757 7:1829650-1829672 TTCCACACATTTCAGAAAATTGG - Intronic
1019766450 7:2854612-2854634 TTCAATACATTTTAAAGGAGTGG + Intergenic
1020134368 7:5578559-5578581 TTCACTGAATTTCAAAGAACTGG + Intergenic
1020490042 7:8770742-8770764 GTCAACACATTTCAGAGTGCAGG - Intergenic
1020978207 7:15034097-15034119 ATCAATACATTTGGAAGAACTGG + Intergenic
1021838154 7:24701019-24701041 ACTAACACATTTCCAAGAACTGG - Intronic
1022461755 7:30615330-30615352 TTCATCCCATTTCAAAGAATGGG - Intronic
1023534818 7:41197076-41197098 TTCAAGACAATTCAAAGAGTTGG + Intergenic
1024445047 7:49467539-49467561 TTTAAAAGATTTCTAAGAACAGG + Intergenic
1025018336 7:55460808-55460830 TTCCACACATTTCACACAAATGG - Intronic
1026684067 7:72493226-72493248 TTCCAGACATTTCACAGAAATGG + Intergenic
1031337085 7:120548659-120548681 TTCAACAGAAATGAAAGAACAGG + Intronic
1031784067 7:126006577-126006599 TTTTACACATTTCCAAGAAAGGG - Intergenic
1032316146 7:130841006-130841028 TTCTGGACATTTTAAAGAACAGG - Intergenic
1034053113 7:148004685-148004707 TTCATTACATATTAAAGAACAGG - Intronic
1034160783 7:148993018-148993040 TTGAAAGCATTTTAAAGAACTGG - Intergenic
1034497075 7:151429417-151429439 TTGCACTCATTTCACAGAACAGG + Intronic
1035007411 7:155676721-155676743 TTCAACACATCCTAAAGAACTGG - Intronic
1035400992 7:158565583-158565605 TTCAACAACTGTCAAAGCACGGG + Intronic
1036226828 8:6966173-6966195 TTCAATACATTAAAAAGAAGAGG - Intergenic
1038177768 8:25196832-25196854 TACAACTCATTCCAAAGAACTGG - Intronic
1039356640 8:36824723-36824745 TTATACACATTTAAAAAAACAGG - Intronic
1040910104 8:52509220-52509242 CTCAACAAATGTAAAAGAACAGG + Intergenic
1041326041 8:56665586-56665608 TTTAACAAATTGCAGAGAACTGG - Intergenic
1041345105 8:56889057-56889079 ATCTACACATTCCAAAGAAAGGG - Intergenic
1042803004 8:72741432-72741454 TTCAATAGATTTGAAGGAACAGG + Intronic
1042814924 8:72867964-72867986 TACCAATCATTTCAAAGAACTGG - Intronic
1043024813 8:75052712-75052734 CTGAACACATTTTAAAGAAATGG - Intergenic
1045107367 8:98905958-98905980 TTGAACACAGTTCAAAGAGTTGG + Intronic
1045172967 8:99691131-99691153 TTCAGGACATTTCATAGAAATGG - Intronic
1045890784 8:107154601-107154623 TTCAATACATTCCAAAGAAGGGG + Intergenic
1046335819 8:112785769-112785791 CGCAAGACATTTAAAAGAACAGG + Intronic
1046577142 8:116044373-116044395 TTAAAAACATTTCAAACACCTGG - Intergenic
1047874096 8:129116104-129116126 TTGAGCAAATTTCAAAGAAAAGG - Intergenic
1049872177 8:144989086-144989108 TTCAACATTCTTAAAAGAACTGG - Intergenic
1050245324 9:3683354-3683376 CTCAAGACAGTTTAAAGAACTGG + Intergenic
1050743483 9:8849539-8849561 TTCAACTCAATTCAACGAAAAGG + Intronic
1050971282 9:11878897-11878919 TTCAACAAAATTCAAAAAACAGG + Intergenic
1051128000 9:13826595-13826617 ATCAACAAATTTCAGAAAACTGG - Intergenic
1051137741 9:13942008-13942030 TTCAACTCATTTCAAAGCAGAGG + Intergenic
1051570519 9:18552448-18552470 CTCAACAAATTCCAAAGAAATGG - Intronic
1052085343 9:24258538-24258560 TACAACATATATCAAAGAAGTGG - Intergenic
1052576271 9:30295591-30295613 TTCATCATATTTCAAAGGACTGG - Intergenic
1053720452 9:40940757-40940779 TTCAAGGCATTGCAAACAACTGG - Intergenic
1054345532 9:63911374-63911396 TTCAAGGCATTGCAAACAACTGG + Intergenic
1054817775 9:69492062-69492084 TTAAAAACATTTCAAGGCACTGG - Intronic
1055090481 9:72360588-72360610 AAAAACACATTTGAAAGAACTGG - Intronic
1055256469 9:74377328-74377350 TTCAGCACATTACAAACAAAGGG - Intergenic
1055778752 9:79795981-79796003 CTCAACAAATTTCAAAGGATTGG + Intergenic
1056161271 9:83896841-83896863 TTCTAAACATTTCATACAACTGG - Intronic
1056303032 9:85261459-85261481 TTCATCACATTACAGTGAACTGG + Intergenic
1057124625 9:92607090-92607112 TTCAAGACATTTCATACAAATGG - Intronic
1058365608 9:104205110-104205132 TTCAACATCTTTCACAGTACTGG + Intergenic
1059217513 9:112579785-112579807 GTCAACACAGATCAAATAACTGG - Intronic
1059584067 9:115586449-115586471 CTCAACACATTGCAAGGAATAGG + Intergenic
1059649709 9:116304472-116304494 TTTAAAACATTTCTAAGAACTGG - Intronic
1060090345 9:120737200-120737222 TTCTACACATTTCATACAAATGG + Intergenic
1060685906 9:125612351-125612373 CTCAACGAATTTCAAATAACTGG + Intronic
1061688210 9:132301800-132301822 TTCTACGCATTTCAAACAAGTGG + Intronic
1203454683 Un_GL000219v1:155111-155133 TTCAAGGCATTGCAAACAACCGG + Intergenic
1185560103 X:1054177-1054199 TTCAGCACATTTCATTGAAAGGG - Intergenic
1186758432 X:12697943-12697965 TACAAGGCATTTCAAAGAAGAGG - Intronic
1187909676 X:24099747-24099769 CTCAATAAATTTAAAAGAACTGG - Intergenic
1188272980 X:28164927-28164949 CTCAGCAAATTTTAAAGAACAGG - Intergenic
1188461823 X:30436016-30436038 ATGAACTCATTTCAAATAACAGG + Intergenic
1188642616 X:32524712-32524734 TTCAAATCAATTCAAACAACAGG + Intronic
1188745081 X:33831325-33831347 TTCAACACAAATAAAAGAAGTGG - Intergenic
1188803180 X:34556713-34556735 TTGAACACAGTTCAAACAGCTGG - Intergenic
1189087697 X:38044182-38044204 TTCAACAAATTTCAAAGAAATGG + Intronic
1189687851 X:43584577-43584599 TTCTAAACATTTCATAGAAATGG + Intergenic
1192543227 X:71992603-71992625 TGGAACACATTTCAAAGCCCTGG + Intergenic
1192928180 X:75778297-75778319 TTGATTACATTTCAAAGAAATGG + Intergenic
1192964471 X:76162394-76162416 AACATCACATTTAAAAGAACTGG + Intergenic
1193987867 X:88268644-88268666 TTGAACAAACTTCAAATAACTGG - Intergenic
1195662357 X:107392584-107392606 TTCAAGACATTTTAAAGAAGAGG + Intergenic
1199064429 X:143397807-143397829 TTCATTACATTACAAAGATCAGG + Intergenic
1199160327 X:144602020-144602042 TTTAACAAGTTTCAAAGAATTGG + Intergenic
1200462206 Y:3471451-3471473 TTGAACACAATTCAAACAGCTGG - Intergenic
1200848090 Y:7852224-7852246 TTCAACCCATTGCAATGAAGGGG + Intergenic
1201681037 Y:16643822-16643844 CTCACCACATAACAAAGAACAGG + Intergenic
1202034989 Y:20623634-20623656 ATCAACAAATTTCAAAAACCAGG + Intergenic
1202051355 Y:20784062-20784084 TTCAATGCATGTCAAACAACAGG - Intergenic