ID: 912267508

View in Genome Browser
Species Human (GRCh38)
Location 1:108173766-108173788
Sequence CAAAATGCTGATAGTAATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 9, 1: 53, 2: 87, 3: 87, 4: 351}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912267504_912267508 4 Left 912267504 1:108173739-108173761 CCCAGAGACTTGTTGAATTGCTT 0: 23
1: 1537
2: 1943
3: 1506
4: 994
Right 912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG 0: 9
1: 53
2: 87
3: 87
4: 351
912267505_912267508 3 Left 912267505 1:108173740-108173762 CCAGAGACTTGTTGAATTGCTTT No data
Right 912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG 0: 9
1: 53
2: 87
3: 87
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912267508 Original CRISPR CAAAATGCTGATAGTAATAT GGG Intronic