ID: 912269294

View in Genome Browser
Species Human (GRCh38)
Location 1:108192901-108192923
Sequence CTTCTGATCAGACGTGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912269294_912269303 11 Left 912269294 1:108192901-108192923 CCTCACTCACGTCTGATCAGAAG No data
Right 912269303 1:108192935-108192957 ACTCCAGGAAGAGTCCAGTCGGG 0: 1
1: 0
2: 1
3: 14
4: 152
912269294_912269296 -4 Left 912269294 1:108192901-108192923 CCTCACTCACGTCTGATCAGAAG No data
Right 912269296 1:108192920-108192942 GAAGCCCCGGCTCCCACTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 263
912269294_912269304 12 Left 912269294 1:108192901-108192923 CCTCACTCACGTCTGATCAGAAG No data
Right 912269304 1:108192936-108192958 CTCCAGGAAGAGTCCAGTCGGGG 0: 1
1: 0
2: 2
3: 16
4: 138
912269294_912269302 10 Left 912269294 1:108192901-108192923 CCTCACTCACGTCTGATCAGAAG No data
Right 912269302 1:108192934-108192956 CACTCCAGGAAGAGTCCAGTCGG 0: 1
1: 0
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912269294 Original CRISPR CTTCTGATCAGACGTGAGTG AGG (reversed) Intronic
No off target data available for this crispr