ID: 912269511

View in Genome Browser
Species Human (GRCh38)
Location 1:108194494-108194516
Sequence GCCTGTTTTCCTTATCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912269511_912269512 3 Left 912269511 1:108194494-108194516 CCAGGGTGATAAGGAAAACAGGC No data
Right 912269512 1:108194520-108194542 CAGCATTTAACAGAATTGACAGG 0: 1
1: 0
2: 1
3: 20
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912269511 Original CRISPR GCCTGTTTTCCTTATCACCC TGG (reversed) Intronic
No off target data available for this crispr