ID: 912271546

View in Genome Browser
Species Human (GRCh38)
Location 1:108215574-108215596
Sequence CAGGAGTTTGAGATCAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912271546_912271553 2 Left 912271546 1:108215574-108215596 CCCCGTCTGATCTCAAACTCCTG No data
Right 912271553 1:108215599-108215621 TTCAAGGAATCCTCCCTCCTTGG No data
912271546_912271559 19 Left 912271546 1:108215574-108215596 CCCCGTCTGATCTCAAACTCCTG No data
Right 912271559 1:108215616-108215638 CCTTGGGTTTCCAAACTGCCTGG No data
912271546_912271554 3 Left 912271546 1:108215574-108215596 CCCCGTCTGATCTCAAACTCCTG No data
Right 912271554 1:108215600-108215622 TCAAGGAATCCTCCCTCCTTGGG No data
912271546_912271560 27 Left 912271546 1:108215574-108215596 CCCCGTCTGATCTCAAACTCCTG No data
Right 912271560 1:108215624-108215646 TTCCAAACTGCCTGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912271546 Original CRISPR CAGGAGTTTGAGATCAGACG GGG (reversed) Intergenic
No off target data available for this crispr