ID: 912272623

View in Genome Browser
Species Human (GRCh38)
Location 1:108226570-108226592
Sequence CAGCTGTTGGAGAGAACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 3, 1: 0, 2: 1, 3: 25, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912272618_912272623 16 Left 912272618 1:108226531-108226553 CCCATGGGACACAGAGCTAAGAC 0: 3
1: 0
2: 8
3: 21
4: 175
Right 912272623 1:108226570-108226592 CAGCTGTTGGAGAGAACAAATGG 0: 3
1: 0
2: 1
3: 25
4: 267
912272621_912272623 -6 Left 912272621 1:108226553-108226575 CCAGACAGAGGTTAGAGCAGCTG 0: 3
1: 0
2: 6
3: 24
4: 192
Right 912272623 1:108226570-108226592 CAGCTGTTGGAGAGAACAAATGG 0: 3
1: 0
2: 1
3: 25
4: 267
912272619_912272623 15 Left 912272619 1:108226532-108226554 CCATGGGACACAGAGCTAAGACC 0: 3
1: 1
2: 8
3: 20
4: 233
Right 912272623 1:108226570-108226592 CAGCTGTTGGAGAGAACAAATGG 0: 3
1: 0
2: 1
3: 25
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912272623 Original CRISPR CAGCTGTTGGAGAGAACAAA TGG Intronic
900700203 1:4043428-4043450 CAGCTGATGGGGAGAGGAAAAGG - Intergenic
900827166 1:4935972-4935994 GTGCTGCTGGAGAGAACAGAGGG + Intergenic
900961144 1:5921334-5921356 CGACTGTTAGAGAGAACAACCGG - Intronic
902357955 1:15920934-15920956 CAGCTGTAAAAGAGACCAAAGGG + Exonic
903117510 1:21190379-21190401 CAACTGTTAGGGAGAAGAAAGGG - Intergenic
903564895 1:24257872-24257894 CAGCTGATGGAAAGATCAATTGG + Intergenic
903920885 1:26799853-26799875 CAGCTGTTGGCAAGGAGAAAGGG - Intergenic
905664542 1:39755011-39755033 CAGCCACTGAAGAGAACAAATGG + Intronic
905902015 1:41588004-41588026 CAGCTGCTGGACAGAAGAAAGGG + Intronic
906927539 1:50135083-50135105 CAGCCACTGGAGAGAACAAGAGG - Intronic
906990373 1:50731041-50731063 GAGATACTGGAGAGAACAAAAGG + Intronic
908646633 1:66285507-66285529 TGGCTGTTGGAGACTACAAAAGG - Intronic
910972409 1:92869509-92869531 CAACTTTTGAAGAGAATAAAAGG + Intronic
912106896 1:106289722-106289744 CAGCTGTTGGACAAAGCACAGGG - Intergenic
912272623 1:108226570-108226592 CAGCTGTTGGAGAGAACAAATGG + Intronic
912295596 1:108467752-108467774 CAGCTGTTGGAGAGAACAAATGG - Intronic
912474854 1:109928832-109928854 CAGCTGTGGGAGAGAAGGAAAGG - Exonic
914451972 1:147800575-147800597 GTGATGTCGGAGAGAACAAAGGG - Intergenic
915472650 1:156135167-156135189 CAGCTGGAGGGGAGGACAAAGGG - Exonic
916969706 1:169999091-169999113 CAGCTATTAGAGAGATTAAATGG + Intronic
917652468 1:177092074-177092096 CAGCTGATGCAGAAAACAATTGG - Intronic
918923872 1:190753469-190753491 CAGCTGTTTGAGGGCACAACTGG + Intergenic
920422097 1:205841911-205841933 CAGATGTTAGAAAGAACCAATGG + Intronic
920987698 1:210906046-210906068 CAGCTGATGGAGGGGACAAGGGG + Intronic
922679493 1:227579931-227579953 CAGCTGATGCAGAGCCCAAAGGG - Intronic
923376622 1:233370140-233370162 GTGCAGATGGAGAGAACAAAAGG + Intronic
923550123 1:234957211-234957233 CAGCTGTGGGGAAGAACAAAAGG - Intergenic
923900682 1:238322969-238322991 CAGATTATGGAGAGAACAATGGG - Intergenic
1063822449 10:9853601-9853623 CAGCTGATGGAGACACCCAATGG - Intergenic
1064290062 10:14025683-14025705 CAGCTGTGGGAGGGGAGAAATGG - Intronic
1064907933 10:20368259-20368281 CAGCAGTTAAAGAGGACAAAGGG - Intergenic
1065943430 10:30585339-30585361 CAGATATTGGAGACTACAAAAGG - Intergenic
1067337625 10:45377974-45377996 CAGATGCTGGAGAGAAACAAGGG - Intronic
1069063648 10:63920024-63920046 CAGCAGTTGGAGAGTACAGCTGG - Intergenic
1069645681 10:69994410-69994432 CAGCTGCTGGAAAGAGGAAAAGG + Intergenic
1069957192 10:72059549-72059571 CAGCCCCTGGGGAGAACAAATGG - Exonic
1070995048 10:80771086-80771108 CAGGTGTTGGCTAGATCAAAAGG + Intergenic
1074125939 10:110529095-110529117 CAGCTGTTTGAAAGGAAAAAAGG - Intergenic
1074469129 10:113711230-113711252 CTGCTATTGGACAGAAGAAAGGG - Intronic
1076911193 10:133390887-133390909 CAGCTTTTAGAGAAAACAAGGGG - Exonic
1077082376 11:729791-729813 CAGCTGTGGGGGAGGACAGAAGG - Intergenic
1078079000 11:8190533-8190555 CAGCTGTGAGAATGAACAAAAGG - Intergenic
1079303351 11:19299272-19299294 CAGGATTTGGAGAGATCAAAAGG - Intergenic
1079959710 11:26907990-26908012 CAGATGTTGGAGAGACCAAGAGG - Intergenic
1080035599 11:27706747-27706769 CAGCTGTTGGGAAAAACTAAAGG + Intronic
1080424363 11:32142738-32142760 CAGCCATTGGAGATCACAAAAGG - Intergenic
1081137738 11:39459938-39459960 CTGCTGTTGTGGAGAACCAATGG - Intergenic
1083314404 11:61805358-61805380 CAGCTGTGGGACGGAACAGAGGG + Intronic
1083546944 11:63555945-63555967 CAGGTGTTCGTTAGAACAAATGG + Intronic
1083792945 11:64997508-64997530 TGGCTGTTGGATAGAACAGATGG + Intergenic
1083988363 11:66231714-66231736 CTGCTGTCTGAGGGAACAAAAGG - Intronic
1085228994 11:74948789-74948811 CAGCTGCTTGAGAGAATAATCGG + Intronic
1085598517 11:77832803-77832825 CTGCTGTTACAGAGCACAAATGG - Intronic
1085955400 11:81387134-81387156 GAGATGTTGAAAAGAACAAAGGG - Intergenic
1086197154 11:84154458-84154480 CATCTGTTTGAAAGAACAAGGGG - Intronic
1087188086 11:95223447-95223469 CAGCTGTTGCACAGTACTAAAGG + Intronic
1087582383 11:100074273-100074295 GAGCAGTTAGAGAAAACAAAAGG + Exonic
1088119922 11:106356382-106356404 CAGTTTTTGGAGAGAAAAAATGG + Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1088777888 11:113103745-113103767 CAGCTGTGGCAGAGACCATATGG - Intronic
1089019256 11:115195283-115195305 CAGATATTGGTAAGAACAAATGG + Intronic
1089178523 11:116565108-116565130 CAGTGGCTGGAGAGAAGAAATGG - Intergenic
1090211706 11:124925252-124925274 TGGCTGTGAGAGAGAACAAAGGG - Intronic
1090269539 11:125376388-125376410 CACCAGATGGAGAGAACAGAGGG - Intronic
1094040927 12:26121817-26121839 CAGCTGGTGGGGGGAAGAAAGGG + Exonic
1094649934 12:32365755-32365777 AAGCTGTTGGAGAAGACAAAAGG + Intronic
1096463247 12:51834422-51834444 CTTCTGTGGGAGAGGACAAAAGG + Intergenic
1097375278 12:58835892-58835914 CAGCTGTTTGAGAAAACCCATGG + Intergenic
1098484287 12:71002674-71002696 CAGATTTTGGAAAGCACAAAGGG + Intergenic
1100599990 12:96104805-96104827 CAGTTGTTGCAGAGACCATATGG - Intergenic
1100846334 12:98661875-98661897 AAGTTTTTGGAGAGAACAACTGG + Intronic
1102079069 12:110083539-110083561 CATCTGTGGGATAGAAGAAAAGG + Intergenic
1104263352 12:127205905-127205927 CAGCTCCAGGAGAGAACAAAAGG + Intergenic
1104642398 12:130475843-130475865 CAGGTGTTGGTGAGGACAGAGGG + Intronic
1104835968 12:131790969-131790991 CAGGTGGGGGAAAGAACAAATGG + Intronic
1105660283 13:22486839-22486861 AAGGTTTTAGAGAGAACAAAAGG - Intergenic
1105941728 13:25153459-25153481 CAGCCTTCAGAGAGAACAAATGG + Intergenic
1106051766 13:26197235-26197257 CAGGTGTTGGCTGGAACAAATGG - Intronic
1106514151 13:30438571-30438593 CAGCCTTTGGAGACTACAAAGGG - Intergenic
1107418301 13:40221650-40221672 CCTCGGTTGGAGAAAACAAAAGG - Intergenic
1108041602 13:46344358-46344380 TAGCTGTTGTAGAGACCACATGG - Intronic
1108498042 13:51044369-51044391 TAGCTGCTGGAGAGACAAAAGGG + Intergenic
1108614445 13:52117785-52117807 CTGCTGTGGAAGAGAACCAAAGG + Intronic
1111185689 13:84732611-84732633 AAGCTGTTTCAGAGACCAAATGG + Intergenic
1111410360 13:87868147-87868169 CTGGTGTTGGCCAGAACAAATGG + Intergenic
1113439975 13:110320812-110320834 CATCAGTGAGAGAGAACAAAAGG + Intronic
1114995643 14:28348709-28348731 CAGCTGTTAAAGAGTACAAAGGG - Intergenic
1115185589 14:30684382-30684404 CAGGGTTTGGAAAGAACAAAGGG - Intronic
1116082799 14:40197840-40197862 CAGATGTTTTAGAGAACTAAAGG - Intergenic
1116531730 14:45980367-45980389 CAGCTCATGGAGATAAAAAAAGG - Intergenic
1117288945 14:54313926-54313948 CAGCAGTCAAAGAGAACAAAAGG - Intergenic
1118229421 14:63933872-63933894 CAGCCTTTGAAAAGAACAAAAGG + Intronic
1118364716 14:65084887-65084909 CAGCTTTTGGGGAGAAAAAAAGG + Intronic
1119205053 14:72787976-72787998 CAGGTGCTGGAGAGAAGAGAGGG + Intronic
1119432157 14:74575518-74575540 CAGCTGTTGGACACAACACCAGG - Intronic
1119677336 14:76565726-76565748 CAGCAGTTGGTGTGAATAAATGG + Intergenic
1119677542 14:76567024-76567046 CAGCAGTTGGTGTGAATAAATGG - Intergenic
1121868700 14:97387241-97387263 TAGATTTTGGAGAGAACAAAAGG - Intergenic
1123139119 14:106058142-106058164 GAGCTGTGGGAGGGAACAACTGG + Intergenic
1123139815 14:106063989-106064011 GAGCTGTGGGAGGGAACAACTGG + Intergenic
1123157072 14:106237351-106237373 GAGCTGTGGGAGGGAACAACTGG + Intergenic
1123186409 14:106521444-106521466 GAGCTGTGGGAGGGAACAACTGG + Intergenic
1123188340 14:106541384-106541406 GAGCTGTGGGAGGGAACAACTGG + Intergenic
1123197822 14:106633471-106633493 GAGCTGTGGGAGGGAACAACTGG + Intergenic
1126286072 15:47012463-47012485 AAGCTGCTGCATAGAACAAAAGG + Intergenic
1126913215 15:53436854-53436876 CACCAGGTGGAGAGAACACATGG - Intergenic
1129024475 15:72557065-72557087 CAGATGTTGGTGAGATCACAGGG - Intronic
1129537852 15:76328852-76328874 TACATGTTGGAGAGAATAAATGG + Intergenic
1130341078 15:82999590-82999612 CGGCTGTAGAAGAGAACTAAAGG + Intronic
1132181111 15:99753622-99753644 CAGCTGATGGGAAGAAAAAATGG + Intergenic
1135009160 16:18858169-18858191 CAGTTGTTGGAGAAAATTAAAGG - Exonic
1135037419 16:19089728-19089750 CAGATGTTGGGCAGATCAAAAGG + Intergenic
1135410036 16:22226825-22226847 CAGCACTTTGAGAGGACAAAAGG + Intronic
1135840125 16:25868631-25868653 TAGCTGCTGGAGGGAACACAAGG - Intronic
1136869792 16:33796092-33796114 GAGCTGTGGGAGGGAACAACTGG - Intergenic
1137956143 16:52832015-52832037 TAGCTGTTGGACAGAAGAAAGGG - Intergenic
1138109176 16:54309642-54309664 CGGCTGATGAAGTGAACAAAGGG + Intergenic
1139159739 16:64490131-64490153 CAGCTGTTGAGGAAAAAAAAAGG + Intergenic
1139933618 16:70550630-70550652 CACCTGTGGAAGAGAAAAAAAGG - Intronic
1142424599 16:89994663-89994685 CAGCCAGAGGAGAGAACAAAAGG - Intergenic
1203102380 16_KI270728v1_random:1319963-1319985 GAGCTGTGGGAGGGAACAACTGG + Intergenic
1146470547 17:33121029-33121051 GAGCTGTTGTAAAGATCAAAAGG + Intronic
1146578382 17:34014047-34014069 CAGCTCTAGGAGAGGAGAAAAGG - Intronic
1146644414 17:34567590-34567612 GAGCTGTCGGACAGAACTAAAGG + Intergenic
1148645631 17:49218318-49218340 CTGCTGTTGGTGAGAAGAAGCGG + Intronic
1149578806 17:57733076-57733098 CAGGTGCTGGAGAGGACAGAGGG - Intergenic
1203162288 17_GL000205v2_random:63297-63319 CAGCTGTAGCAGAAAAAAAAAGG - Intergenic
1153582504 18:6588734-6588756 AAGCTGTTGGAAAGAAAGAATGG + Intronic
1153816590 18:8795731-8795753 CAGCTGGTGGAGAGCACAGCAGG - Intronic
1155761460 18:29573682-29573704 CAGCTGTTAGAGGAAAAAAAAGG + Intergenic
1157185329 18:45535647-45535669 CAACTGTTTGAGTGAGCAAAAGG + Intronic
1158119054 18:54028110-54028132 AAGCTGAAGGATAGAACAAAAGG - Intergenic
1158187606 18:54788664-54788686 AAGCTGAGGGAGAGAACCAAAGG - Intronic
1159855100 18:73577407-73577429 AAGCTGATAGAGAAAACAAAAGG - Intergenic
1162123572 19:8487004-8487026 CAGCTGAAGGGGAGAAGAAAAGG - Exonic
1162828134 19:13266936-13266958 CAGTTCTTGCAGAGAACAGAAGG - Intronic
1164774408 19:30841633-30841655 CAGCTGTTAAAGAGAATAACGGG + Intergenic
1164904357 19:31954813-31954835 CAGCTGGTGGAGAAAGAAAAAGG + Intergenic
1166274112 19:41739657-41739679 CAGCCCTCAGAGAGAACAAATGG + Intronic
1166299449 19:41905819-41905841 CAGCTGATGGTGAGACCAGAGGG + Exonic
1168275052 19:55273353-55273375 AAGCTGTTAGAGAAAATAAAAGG + Intronic
925007193 2:452875-452897 CAGCTGTGGAAGAGAGCAATGGG - Intergenic
926651237 2:15348529-15348551 CAGATTTTGGAAAGAACAAGCGG + Intronic
927525456 2:23735973-23735995 CAAAGGTAGGAGAGAACAAAAGG + Intergenic
929288869 2:40166232-40166254 CAGCTGTTGCAGGGAATGAATGG + Intronic
931446509 2:62331460-62331482 CAGGTATTGGAGAGGAAAAATGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931548342 2:63413850-63413872 GAGCTTTTGCAAAGAACAAAAGG + Intronic
932814227 2:74849078-74849100 CAACAAATGGAGAGAACAAAAGG - Intronic
934678807 2:96267816-96267838 CAACTGTGGGAGAGAAAAAGGGG - Exonic
935263249 2:101372990-101373012 CAAGTGTTGGTGAGGACAAAGGG + Intronic
936956112 2:118023954-118023976 CAGCTGTTGGACAGCCCAGAGGG - Intergenic
937235039 2:120425777-120425799 CATCTTTTGGAGAGAAGAAATGG - Intergenic
937390391 2:121480868-121480890 GAGCTGTTGGAGCCAACAAATGG + Intronic
938236513 2:129710471-129710493 CAGCCTTTGGAGAGAATAGAAGG + Intergenic
941668850 2:168269111-168269133 CAGATTTTGGAGAGGACTAAAGG - Intergenic
942339223 2:174925567-174925589 CAGCCTTTGGAGAGAAAAGATGG - Intronic
944834227 2:203562447-203562469 CAGCTGTTGGAGCTAAAAACAGG - Intergenic
945951107 2:216039772-216039794 AAGCTGTTGGAAAGAAGAGATGG - Intronic
946262804 2:218509990-218510012 CTGCTGTTGGTGAGAGGAAAGGG + Exonic
946426953 2:219604097-219604119 CAGGTGTTGGCTAGAACAAATGG + Intronic
946696038 2:222360220-222360242 CAGCTGTGCAAGAGAGCAAACGG - Intergenic
948131774 2:235606276-235606298 CTGCTGTTGTGGAGAACAGAAGG - Intronic
948586568 2:239023715-239023737 CAGCTGTTGGAGTGGAGGAAAGG - Intergenic
1170726179 20:18928944-18928966 AAAGTCTTGGAGAGAACAAATGG + Intergenic
1173983595 20:47243864-47243886 CTGTTGTTGCAGAGAACAATAGG - Intronic
1175057290 20:56209880-56209902 CAGCTTGTGGAGAGAAGAGATGG + Intergenic
1175856659 20:62124119-62124141 CAGCTGTAACAGAAAACAAAGGG - Intronic
1176743397 21:10627814-10627836 GAGCTGTGGGAGGGAACAACTGG + Intergenic
1178409385 21:32350920-32350942 CAGCTGAGGGAGACAGCAAAAGG + Exonic
1178418454 21:32423654-32423676 CAGGTGTCGGAGAGAACATAAGG - Intronic
1179271177 21:39852269-39852291 CAGGTGTTGGCTGGAACAAATGG - Intergenic
1179950971 21:44708678-44708700 CAGCTGGTGGAGAGACCCCAGGG - Intronic
1182436930 22:30336886-30336908 CAGCTGTTGGAGGCATCTAAGGG - Intronic
1182649614 22:31840531-31840553 CAGCTATTCCAGAGAACAACAGG - Intronic
949786309 3:7745593-7745615 CAACACTTGGAGAGAATAAAAGG - Intergenic
951887812 3:27541008-27541030 CAGCTGAAGGCCAGAACAAAGGG + Intergenic
952389413 3:32866822-32866844 CTGCTGTTGGAGAGGAGTAATGG + Intronic
952580134 3:34823688-34823710 AAGCTGTTGAAAAGATCAAAAGG + Intergenic
956002189 3:64741297-64741319 CAGCTCTTGTAGAGAATAGATGG + Intergenic
956211225 3:66803738-66803760 CAGCTGTTGGAGGGACAAAGAGG - Intergenic
956292830 3:67679472-67679494 GAGGGGTTGGAGAGACCAAAGGG + Intergenic
957334819 3:78814120-78814142 AAGCTGTTGAAGAGTAAAAAAGG - Intronic
958059398 3:88460023-88460045 CAGCAGTTTCATAGAACAAACGG + Intergenic
959859037 3:111195770-111195792 CAGTTTTTAGAGAGAACAGATGG - Intronic
960387260 3:117035392-117035414 CAGCTTTTGGAGACCACAAAAGG + Intronic
961621119 3:128225813-128225835 CAGGTTTTGGAGAGAAGGAAAGG + Intronic
961783581 3:129336164-129336186 CAGCTGTTGGAGTCTACACATGG - Intergenic
962679750 3:137785905-137785927 CAGGTGTTGAAAAGATCAAAAGG - Intergenic
963255984 3:143145453-143145475 CAGCACTTGGAGAGTCCAAAAGG + Intergenic
964335225 3:155647788-155647810 CAGCTGCTTGAGTGAATAAAAGG - Intronic
965665509 3:171089634-171089656 GTGCTGGTGGAGTGAACAAAAGG - Intronic
966649091 3:182279136-182279158 CAGCTGGTGAAGAGAGCAGAAGG - Intergenic
967742115 3:193014970-193014992 CAGCTTTTGGAGAGGAGAGAAGG + Intergenic
967926942 3:194657750-194657772 CAGCTGCAGGAGAGAACCGAAGG + Intronic
968385761 4:136011-136033 CAGCAGGAGGACAGAACAAAAGG - Intronic
970218819 4:13786305-13786327 CAGCACTTGGAGAAAACAGAGGG + Intergenic
970906232 4:21219609-21219631 CAACTGGTTGAGAGAAGAAAGGG + Intronic
971022686 4:22553594-22553616 CAGGTGTTGGAGAGAAACAGCGG - Intergenic
971188303 4:24402361-24402383 GAGCTGTTTGAGAGCCCAAACGG + Intergenic
971779137 4:31008125-31008147 CAGCAGCTGGAGAGGAGAAAAGG + Intronic
971967801 4:33583923-33583945 CTGCTCTTGCAGAGTACAAATGG + Intergenic
972619340 4:40732015-40732037 CAGTTGTTGGAGCTCACAAAAGG + Intergenic
973760063 4:54107552-54107574 CAGCAGGTGCAGAGAAAAAAAGG + Intronic
974827478 4:67149761-67149783 CAGCAGCTAGAGAGAACAATGGG + Intergenic
975222543 4:71829855-71829877 CAGCTCATTGAGAGAACACAAGG + Intergenic
975563128 4:75725353-75725375 CAGCTGTTGGTGAGAGCATTTGG + Intronic
976617024 4:87088455-87088477 CAGCTGTTGCAAGGATCAAATGG + Intronic
978753689 4:112281419-112281441 CCACTGTTAGAGAGAAAAAATGG + Intronic
978802411 4:112767983-112768005 CAGGTGAAGGAGAAAACAAAGGG + Intergenic
980432283 4:132717828-132717850 AATGTGTTGCAGAGAACAAAGGG - Intergenic
981403518 4:144341003-144341025 CTGCTGTTGGAAAGAACCATGGG - Intergenic
984954433 4:185031513-185031535 CAGCTGCTTGGGAGAACAAGGGG + Intergenic
986480433 5:8181206-8181228 CAGTGGTTGGAGAGAGCACAAGG + Intergenic
986805470 5:11304823-11304845 CAGCAGATGGAGAGAACAGGTGG - Intronic
987008748 5:13738487-13738509 CTGCTTTTGGAGAGAACAGCAGG - Intronic
990034285 5:51300971-51300993 GAACTACTGGAGAGAACAAAAGG + Intergenic
990667167 5:58086142-58086164 CAGATGTTGGAGTGAATACATGG - Intergenic
990700038 5:58464917-58464939 CAGCTGTGACAGAGACCAAATGG + Intergenic
992069558 5:73136447-73136469 CAGCTTTGGGAGAGAACACACGG - Intergenic
992639372 5:78755597-78755619 CATCTGTTGAAGAGCACAAATGG - Intronic
993307928 5:86293418-86293440 CAGCTGTTGGAGAGAACAAATGG - Intergenic
993935404 5:93994502-93994524 GAGCTGTGGGAAAGAAGAAATGG + Intronic
994914596 5:105958136-105958158 CAGCAGATGGTGAGAAAAAAAGG + Intergenic
997612340 5:135223991-135224013 CAGCTGTTGGGGTGAAAGAAAGG - Intronic
998657296 5:144195537-144195559 GAGCTGGTGGAGTCAACAAATGG + Intronic
998909314 5:146941210-146941232 CATTTGTTGGGGAGAAGAAAGGG - Intronic
998950421 5:147388319-147388341 CTGCTTTAGGAGAGAACAAAGGG + Intergenic
999002413 5:147939086-147939108 CATCTGTTTGAGAGAAAATAAGG - Intergenic
1000151219 5:158503080-158503102 CAGGGGTTAGAGAGAAGAAAGGG - Intergenic
1000496266 5:161989224-161989246 GAGCTATTGGACAAAACAAAGGG + Intergenic
1001067830 5:168553239-168553261 CAGCTGGTTGAGAGCACTAAAGG + Exonic
1001758813 5:174191151-174191173 AGGCTGTGGGAGAGACCAAAAGG - Intronic
1001934829 5:175696495-175696517 CATCTGTTAGAGAGAAGAACAGG + Intergenic
1002381671 5:178833858-178833880 CAACTGTTGCAGAAAATAAAAGG - Intergenic
1002461394 5:179375752-179375774 CAGCTGGGGGAGAGAAGAAAAGG + Intergenic
1008050065 6:46891896-46891918 AAGCTGTTGGAGAACATAAAAGG - Intronic
1008481124 6:51986385-51986407 CAGTTGCTGAAGAAAACAAAAGG + Intronic
1008555776 6:52671596-52671618 GAGCTCTTGGAGGGCACAAAAGG - Intronic
1012016438 6:93857926-93857948 CACGTGTTGAAGAGAAGAAAAGG - Intergenic
1012115403 6:95290731-95290753 CAGCTATTGGAGAGACCTAGAGG + Intergenic
1013851815 6:114525220-114525242 CAGCTGCTGGAGCCAACACAAGG + Intergenic
1015355163 6:132269416-132269438 AAGCTGTTGGAGAAAAGGAAAGG + Intergenic
1019825480 7:3280712-3280734 CATCTGTTAGAGAGGCCAAAAGG - Intergenic
1020763893 7:12297795-12297817 CAGCCCTTGGAGAGAATAGATGG - Intergenic
1021391913 7:20103287-20103309 GAGCTACTGGAGAGAAAAAATGG + Intergenic
1022570221 7:31445376-31445398 CAGCTGTAGGAGAGAAATAAAGG + Intergenic
1022974766 7:35546933-35546955 CAGTTGTTTGAGAGAATCAAGGG - Intergenic
1024396810 7:48878979-48879001 CAGGTGATGGAGAAATCAAATGG - Intergenic
1024824485 7:53375223-53375245 CAGCGGTTAGTGAGAATAAAGGG - Intergenic
1027228441 7:76259329-76259351 CAGCACTTTGAGAGATCAAACGG + Intronic
1028195246 7:87899123-87899145 AAACTCTTGGAGAGAACACAGGG + Intronic
1029955569 7:104635420-104635442 AAGCTTCTGGAGAGAACAGATGG + Intronic
1029977440 7:104848262-104848284 CAGCTGTTGGAGATAATGGAAGG + Intronic
1030742962 7:113131535-113131557 CAGCAATTGGAGAGACCACAAGG + Intergenic
1030830004 7:114209071-114209093 CAGGTGTTGGAGCGATCAGATGG + Intronic
1030958488 7:115885729-115885751 CAACTTTTGGAGAGAAGCAACGG - Intergenic
1031372119 7:120981114-120981136 CAGATATTGGAGAGCCCAAAAGG - Intergenic
1031870383 7:127084380-127084402 TAGCTGTTGGAGATAGCAAGAGG - Intronic
1032582463 7:133116042-133116064 CAGGAGGAGGAGAGAACAAAGGG - Intergenic
1033531821 7:142271810-142271832 CAACCGTTGAAGAAAACAAAAGG - Intergenic
1034332868 7:150298109-150298131 CAGGTGGTGGAGAGAAGGAAGGG + Intronic
1034665172 7:152811761-152811783 CAGGTGGTGGAGAGAAGGAAGGG - Intronic
1035083498 7:156236747-156236769 CAGATGTTGGAGAGAGCAGGTGG + Intergenic
1035429842 7:158810990-158811012 CAGCTGTTAAAAAAAACAAAAGG + Intronic
1037085916 8:14850407-14850429 CAGAAGATGGAGAAAACAAAGGG + Intronic
1037479652 8:19292514-19292536 AAGCAGCTGGAGAGAATAAAAGG + Intergenic
1040059189 8:43089886-43089908 CACCTGTGGGACATAACAAAAGG - Intergenic
1040542327 8:48371506-48371528 CAGCTGCTTGAGAGAGCCAATGG - Intergenic
1041043850 8:53873201-53873223 CAGCTTTTGGAGAGGTCTAAGGG - Intronic
1041523901 8:58784669-58784691 CTGCTGTTGGACAGAAGGAATGG + Intergenic
1042741374 8:72050912-72050934 CAGCTGTTGTACAGAACAGAAGG - Intronic
1046912823 8:119647326-119647348 CTGCATTTGGAGAGATCAAAAGG - Intronic
1048460788 8:134620062-134620084 AAGGTGCTGGAGAGAACAGAGGG + Intronic
1048583737 8:135753067-135753089 CTGCTATTACAGAGAACAAAGGG - Intergenic
1048972576 8:139653526-139653548 GAGCTGTTGGAGAGAACAAGAGG - Intronic
1050289887 9:4142969-4142991 CAGCTATAAGAGAGAAGAAAGGG - Intronic
1051321468 9:15909963-15909985 CAGATATTGGAGATTACAAAAGG - Intronic
1051351106 9:16198649-16198671 CAGCTGTGGAAGAGCAGAAAAGG - Intergenic
1051847159 9:21464922-21464944 CAGTTGTTTGAAAGAAAAAAAGG + Intergenic
1052273897 9:26656736-26656758 CAGCTGGTGGAGGGGACAAAAGG - Intergenic
1055229896 9:74049712-74049734 CAGCTGTTACAGAAAAAAAATGG + Intergenic
1055995528 9:82154845-82154867 CAGGGGTTGGAGAGAGGAAAGGG + Intergenic
1056074118 9:83020852-83020874 CAGCAGATGGAGAGAAAAAAAGG + Intronic
1056619073 9:88195363-88195385 CAGCTCTCGGAGAGAATACATGG + Intergenic
1057644654 9:96861495-96861517 CAGCTGTTTGGGAGAATTAAGGG + Intronic
1059560632 9:115331365-115331387 TATCTGTTGGAGATAACACAAGG - Intronic
1186013415 X:5163880-5163902 CAGCCCTTGGAGAGAATAGATGG - Intergenic
1186453892 X:9695709-9695731 CAGCTGGTGCAGAGTACAGAGGG + Intronic
1188577834 X:31673969-31673991 AAGCTTTAGGGGAGAACAAAAGG + Intronic
1192759574 X:74082307-74082329 CAGACGTTGGAGACTACAAAAGG - Intergenic
1192882113 X:75296728-75296750 AAGCTGCTGGTGAGCACAAATGG + Intronic
1199202999 X:145115278-145115300 CAGCTTTTGCAGAGATCACATGG - Intergenic
1200637743 Y:5677279-5677301 ATGCTGTGGGAGAGAACAAGTGG - Intronic
1200708524 Y:6463474-6463496 CAGCTATTTAAGAGAGCAAAAGG - Intergenic
1201025588 Y:9701234-9701256 CAGCTATTTAAGAGAGCAAAAGG + Intergenic