ID: 912273154

View in Genome Browser
Species Human (GRCh38)
Location 1:108230194-108230216
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 2, 1: 1, 2: 3, 3: 44, 4: 444}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912273147_912273154 19 Left 912273147 1:108230152-108230174 CCTGAATGGTTTATAGCAGGACA 0: 3
1: 0
2: 0
3: 6
4: 99
Right 912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG 0: 2
1: 1
2: 3
3: 44
4: 444
912273143_912273154 28 Left 912273143 1:108230143-108230165 CCCTTGATCCCTGAATGGTTTAT 0: 3
1: 0
2: 0
3: 25
4: 221
Right 912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG 0: 2
1: 1
2: 3
3: 44
4: 444
912273144_912273154 27 Left 912273144 1:108230144-108230166 CCTTGATCCCTGAATGGTTTATA 0: 3
1: 0
2: 1
3: 11
4: 134
Right 912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG 0: 2
1: 1
2: 3
3: 44
4: 444
912273146_912273154 20 Left 912273146 1:108230151-108230173 CCCTGAATGGTTTATAGCAGGAC 0: 3
1: 0
2: 2
3: 4
4: 99
Right 912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG 0: 2
1: 1
2: 3
3: 44
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900474534 1:2869929-2869951 CCGGGCACACAGCAGGCACAAGG - Intergenic
900779128 1:4606144-4606166 CAGCAGATACAGCAGGTACAGGG - Intergenic
901416797 1:9121990-9122012 CAGGCCATACAGCTGATGCCTGG + Intronic
901635031 1:10666514-10666536 CAGGAGCTCCAGCAGGTGCAGGG + Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902125843 1:14210257-14210279 CAGGCAAGACAGCATGTGCAGGG - Intergenic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902886007 1:19405287-19405309 CATGGCATCCCGCAGGTGCTCGG + Intronic
902919062 1:19655880-19655902 CAGGGAAAAGAACAGGTGCAAGG - Intronic
903420372 1:23214734-23214756 CAGGGCATGGGGCAGGTGGAGGG - Intergenic
903791374 1:25895488-25895510 CTGGGCCTCCAGCAGGGGCAGGG + Intronic
903808410 1:26021383-26021405 GATGGCCCACAGCAGGTGCAGGG + Intronic
904116163 1:28163555-28163577 CAGGTCATACAGCAAGTAAATGG - Intronic
904849266 1:33445054-33445076 CAGGCAAGACAGCATGTGCAGGG - Intergenic
906209283 1:44003153-44003175 CAGGGGCTGCAGCAGGTGGAGGG - Intronic
906733867 1:48105694-48105716 CAGGGGAGATAGCTGGTGCAGGG - Intergenic
907240251 1:53077306-53077328 CAGGGCAGGCGGCAGGTGCTTGG - Exonic
907316454 1:53575683-53575705 CAGGACATGGAGCAGGTGCTTGG + Intronic
907454368 1:54565640-54565662 CCTGGCATACAGTAGGTACATGG + Intronic
908327879 1:63041734-63041756 CAGAGCCTAGAGCAGCTGCATGG + Intergenic
908756302 1:67471932-67471954 TAGGGAAGACAGCAGGTACAAGG + Intergenic
908932925 1:69339452-69339474 CAGGCAAGACAGCATGTGCAGGG - Intergenic
909068558 1:70964498-70964520 CAGGAAAGACAGCATGTGCAGGG + Intronic
910664291 1:89707750-89707772 CAAGCCATACAGCAGGTGGCTGG - Intronic
911041836 1:93597489-93597511 GAGGCCACACAGCAGGTGCGTGG - Intronic
911110989 1:94185111-94185133 CTGGGCAAACTGCAGGTGGAAGG + Intronic
911363293 1:96906175-96906197 CAGGGCATACAGCACAGGCCTGG + Intergenic
911799143 1:102111276-102111298 CAGGCAAGACAGCATGTGCAGGG + Intergenic
911926036 1:103834231-103834253 CAGGCAATATAGCATGTGCAGGG - Intergenic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912701503 1:111881654-111881676 CAGGGCAAAGGGCAGGGGCATGG + Intronic
913966348 1:143380533-143380555 CCTGGCATACAGCAGGTGCCTGG - Intergenic
914060721 1:144206140-144206162 CCTGGCATACAGCAGGTGCCTGG - Intergenic
914118429 1:144760229-144760251 CCTGGCATACAGCAGGTGCCTGG + Intergenic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
917712815 1:177704465-177704487 CAGAGCACACAGCAGGTCTATGG - Intergenic
917836080 1:178942567-178942589 CAGGTCACACAGCTGGTGCCTGG + Intergenic
918306389 1:183250576-183250598 CAGGTCAGCCAGCAGGTGTAGGG - Exonic
919979051 1:202630990-202631012 CACGGCATTCGGCAGCTGCAGGG + Intronic
920259393 1:204678674-204678696 CAGAGGGGACAGCAGGTGCAAGG - Intronic
920536128 1:206737618-206737640 CAGGACATACACCAAGTGCCTGG - Intergenic
922209389 1:223476046-223476068 CAGGGCATAAAGCAGGCTCCCGG - Intergenic
922707364 1:227796453-227796475 CAGGGCACATTGCAGGTACATGG - Intergenic
922719230 1:227891869-227891891 TGGGGCAGAAAGCAGGTGCAGGG - Intergenic
922725461 1:227920964-227920986 CGGGGCGTACAGCTGGAGCAGGG - Exonic
922897723 1:229113454-229113476 CATGGCAGACAGCAAGTGCTGGG - Intergenic
923680363 1:236113781-236113803 CAGGGCCTCCAGAGGGTGCACGG - Intergenic
924207123 1:241725019-241725041 AAAGGCAGACAGCAGGGGCAGGG + Intronic
1063185576 10:3647816-3647838 CAGGACTTGCAGCAGGGGCAGGG - Intergenic
1063462766 10:6225027-6225049 CAAGGTAGACAGCAGCTGCACGG - Intronic
1063807429 10:9661621-9661643 CAGGGCTTCCAGCAGGGGCCAGG - Intergenic
1064232872 10:13544868-13544890 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1065808768 10:29421584-29421606 CAGGCAGTACAGCAGCTGCATGG + Intergenic
1066471891 10:35706625-35706647 GAGGGCCTACAGGAGGTGGAGGG - Intergenic
1067145599 10:43691612-43691634 CAGGGCTGCCAGCAGGGGCATGG - Intergenic
1069099800 10:64306146-64306168 CAGGCAAGACAGCATGTGCAGGG + Intergenic
1069313202 10:67065235-67065257 AAGGCCATACAGCATGTGTATGG - Intronic
1069524320 10:69154197-69154219 CAGGGGATTCAGCAGGTAAATGG + Intronic
1069537354 10:69264716-69264738 CAGGGGATTCAGCAGGTAAATGG - Intronic
1069944186 10:71974693-71974715 GAGGGCAGACAGCAGGTGGGCGG - Intronic
1070530866 10:77336031-77336053 TAATGCATACAGCAGATGCAGGG + Intronic
1070540573 10:77412522-77412544 CAGGGCACACAGCCTGTGCCTGG - Intronic
1072782592 10:98260676-98260698 CAGGACATCCAGCAGGTGTTGGG - Intronic
1075265612 10:120997954-120997976 CAGAGCATTCAGCAAGTGCCTGG + Intergenic
1076002013 10:126919830-126919852 CAGGGACCACAGCAGGTGCTGGG - Intronic
1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG + Intronic
1077335749 11:2003201-2003223 CAGGGCCTCCAGCAGGAACAGGG - Intergenic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1077415483 11:2422566-2422588 CAGGTCACACAGCAGGTCAAGGG - Intronic
1077614525 11:3665571-3665593 CAGGGCATCGAGGAGGTGCTAGG + Exonic
1078064743 11:8071059-8071081 CAAGGCATACAGGTGGTTCATGG + Intronic
1078068454 11:8093262-8093284 CAGTGCAGGCAGCAGGAGCAAGG + Intronic
1078082334 11:8213259-8213281 CAGGGCAGACAGCAGGGGTGAGG - Intergenic
1078199870 11:9171189-9171211 CAGGGCATTCAGCAGGGTAATGG + Intronic
1079100407 11:17538189-17538211 CAGGGCTGGCAGCAGGGGCAGGG - Intronic
1079176308 11:18144590-18144612 CAGGCAAGACAGCACGTGCAGGG + Intronic
1079404193 11:20130732-20130754 CAGGGAATGCAGCAAGTTCATGG - Intergenic
1080505765 11:32911665-32911687 CAGGAGAGACAGCAAGTGCAAGG - Intronic
1081249557 11:40813358-40813380 CAGGGCAGAGAGCTTGTGCAGGG + Intronic
1081356466 11:42120487-42120509 CAGGGAAGACAGCATGTGTAGGG - Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081593708 11:44444723-44444745 CAGGTCACACAGCTGGTGAATGG - Intergenic
1082722904 11:56700764-56700786 CTGGGCATAAAGCAGGGGCTTGG - Exonic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1083134371 11:60657920-60657942 CAGGGGATAAAGTAGTTGCAGGG + Intergenic
1083189875 11:61042180-61042202 CAGGGCATAATTCAGGTGCCAGG + Intergenic
1083307466 11:61768852-61768874 CAGGGCATTCAGCAGGTCATGGG - Intronic
1083769981 11:64861436-64861458 CAGGGCATACAGCAGGCAGGTGG - Intronic
1084495430 11:69500637-69500659 CTGGCCAGACAGCAGGTGCAGGG + Intergenic
1084564315 11:69920669-69920691 CAGGGGATGCACCAGCTGCATGG + Intergenic
1085172075 11:74457882-74457904 CAGGCAAGAGAGCAGGTGCAGGG - Intronic
1090236526 11:125152331-125152353 CAGCTCATACAAAAGGTGCAAGG - Intergenic
1091321479 11:134655381-134655403 GTGGGCATGAAGCAGGTGCATGG - Intergenic
1202818733 11_KI270721v1_random:58383-58405 CAGGGCCTCCAGCAGGAACAGGG - Intergenic
1091404745 12:202198-202220 CAGGGGGAAGAGCAGGTGCAGGG - Intronic
1092008012 12:5085833-5085855 CAGAGCCTAAAGAAGGTGCAGGG - Intergenic
1092049170 12:5455742-5455764 CAGGGCACACAGCAGCTGATCGG + Intronic
1093296175 12:17394884-17394906 CAGGCAAGACAGCATGTGCAGGG + Intergenic
1093783133 12:23160173-23160195 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1094147782 12:27248522-27248544 CAGGGAATACAGCAGGTGAGCGG + Intronic
1095950583 12:47779739-47779761 CAGGCCACACAGCAGGTGAGGGG + Intronic
1100478175 12:94953096-94953118 CAGGACATGCAGCAGGAGTATGG - Intronic
1101404509 12:104416087-104416109 CATGGCATTGAGCAGGTGAAGGG + Intergenic
1101724673 12:107379047-107379069 AAGGTCATTCAGCAGGTACATGG - Intronic
1102199656 12:111048561-111048583 CTGGACATAGAGCTGGTGCAAGG + Intronic
1103016775 12:117500804-117500826 CAGGACATGCAGCAGGAGCTGGG + Intronic
1103245061 12:119449748-119449770 CAGGTCAATCAGCAGGTTCATGG + Intronic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1103983559 12:124752287-124752309 CCTGGCATACAGTAGGTGCTCGG - Intergenic
1104411087 12:128558432-128558454 CAGGTAAGACAGCATGTGCAGGG - Intronic
1104953112 12:132451262-132451284 CAGGGCATCCAGGAGGGGCCAGG + Intergenic
1107725823 13:43298338-43298360 CAAGGCATGCAGCAGGTACCTGG - Exonic
1107729190 13:43331281-43331303 CAAGGAATACAAGAGGTGCAGGG - Intronic
1108148747 13:47508442-47508464 CAAGGCATCTAGCAGGTGCCTGG - Intergenic
1108532875 13:51343879-51343901 CTGGGAAAACAGCAGGTCCAGGG - Intronic
1109189939 13:59312147-59312169 CAGGGCATTCAGTAGGCCCAAGG + Intergenic
1109280397 13:60349078-60349100 CAGAGCAGACTGCAGCTGCAGGG + Intergenic
1109478759 13:62919738-62919760 CAGAGCAGACACCAGGAGCAGGG + Intergenic
1110134768 13:72052440-72052462 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1110264925 13:73526765-73526787 CATGTCCTACAGCAGGTGAATGG + Intergenic
1111799208 13:92961229-92961251 CAGGCAAGACAGCATGTGCAGGG + Intergenic
1113566739 13:111323827-111323849 CAGGGATCACAGCAGGTTCAGGG - Intronic
1114904508 14:27109445-27109467 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1114936910 14:27549638-27549660 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1116056835 14:39874410-39874432 CAGGGCATACATCAGGTTTTCGG + Intergenic
1116076066 14:40112626-40112648 CAGGGCAGCCAGCAGGGGTAGGG + Intergenic
1117854311 14:60011230-60011252 CAGGCAAGACAGCATGTGCACGG + Intronic
1118014063 14:61640583-61640605 CATAGCATCCAGCAGGAGCAAGG + Intronic
1119110008 14:71963143-71963165 CAGAGCATATAGCAGGTGTTTGG + Intronic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1122142664 14:99672179-99672201 CAGGCCACACAGTAGGTGCATGG + Intronic
1122783128 14:104152142-104152164 AGGGGCCTGCAGCAGGTGCATGG - Exonic
1123731582 15:23150300-23150322 CAGAGCATACAGCATATGCCAGG + Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1124494648 15:30178869-30178891 CATGGCATTCGGCAGCTGCAGGG + Intergenic
1124614386 15:31231020-31231042 CAGGGCCTGGAGCACGTGCAAGG + Intergenic
1124748922 15:32359776-32359798 CATGGCATTCGGCAGCTGCAGGG - Intergenic
1124886987 15:33696398-33696420 CAGGGCAGCCAGCAGGTTGATGG - Exonic
1125676748 15:41506085-41506107 CTGGGCATATGGCAGGGGCAGGG - Intronic
1125680844 15:41529375-41529397 CAGGGCACACAGAAGGTCAAAGG + Intronic
1125744270 15:41988113-41988135 CCAGGCATCCAGCAGGTTCAGGG + Exonic
1125757110 15:42071508-42071530 CCAGGCATCCAGCAGGTTCAGGG + Exonic
1127729226 15:61783333-61783355 AAGGGCAGACAGCAGGTCTAGGG - Intergenic
1128028254 15:64457873-64457895 CAAGGCATCCAGCATGTGGAGGG + Intergenic
1128527965 15:68425271-68425293 CAGGGCATTCACCAAGTGCAGGG - Intronic
1128784780 15:70386791-70386813 TAGGACAGAGAGCAGGTGCATGG + Intergenic
1129517408 15:76165125-76165147 CAGGGCCTGGACCAGGTGCAAGG + Intronic
1129685630 15:77684780-77684802 CCTGGCACACAGTAGGTGCATGG - Intronic
1129739933 15:77985259-77985281 CAGGGCACATGGCAGTTGCAAGG - Intronic
1130044121 15:80430899-80430921 CCCAGCACACAGCAGGTGCAGGG - Intronic
1130216823 15:81979494-81979516 CAGGTCAGAGAGCATGTGCAGGG - Intergenic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130688634 15:86060980-86061002 CAGGTCATCCAGCTGGTCCATGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132586127 16:706335-706357 CCGGGCACGCAGCAGGTGCGCGG - Intronic
1132875952 16:2137274-2137296 CAGGTCACACAGCAGGTGGATGG + Intergenic
1133981288 16:10635088-10635110 CAAGTCATACAGCACGTTCATGG + Intronic
1134271969 16:12740753-12740775 CAGAGTGAACAGCAGGTGCAAGG + Intronic
1134285440 16:12857652-12857674 CAGGCAAGACAGCATGTGCAGGG + Intergenic
1136054949 16:27681487-27681509 CTGGGAATACAGCAGGAGCTTGG - Exonic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1136235056 16:28908640-28908662 CAGGGCTCGCAGCAGGAGCAGGG - Exonic
1137399651 16:48142958-48142980 CAGGGAGTAGAGCAGGAGCATGG + Intronic
1137584701 16:49657449-49657471 CTGGGAATTCAGCAGCTGCAGGG + Intronic
1138454705 16:57114545-57114567 CAGGGCACAGAGCAGGTGTGTGG + Intronic
1139254792 16:65530596-65530618 CAGGCAAGACAGCATGTGCAGGG + Intergenic
1140465950 16:75182883-75182905 CTGGGATTACAGGAGGTGCAGGG - Intergenic
1141858592 16:86701372-86701394 GCGGGCATGCAGCAGGTGCTCGG + Intergenic
1142891955 17:2949439-2949461 CAGGGCATAGAGCAGGCACTCGG - Intronic
1143112180 17:4558921-4558943 GCGTGCATGCAGCAGGTGCAGGG + Exonic
1143130721 17:4675282-4675304 GAGTGCAGACAGCAGGTCCAAGG + Exonic
1144460041 17:15451208-15451230 CAGGCAAGACAGCATGTGCAGGG - Intronic
1144726984 17:17506975-17506997 CAGAGCATACAGCAGGCCCAAGG + Intronic
1144757946 17:17691622-17691644 CCGGGCACACACCAGGTGCCTGG - Intronic
1144767791 17:17742177-17742199 CAGGGCCCACAGCAGATGCCAGG + Intronic
1144952394 17:19001248-19001270 CAGGGCAGAAAGCAGGGGCTTGG + Intronic
1145017598 17:19409346-19409368 CAGGGCAAACCACAGGTACAGGG - Intergenic
1146451786 17:32980676-32980698 CAGGCCAGAGAGCATGTGCAGGG + Intronic
1147332724 17:39708318-39708340 CAGGATATCCAGGAGGTGCAGGG + Exonic
1147446284 17:40477163-40477185 CGTGGCAGACAGCAGGTGCCTGG - Exonic
1148000152 17:44383108-44383130 CAGGCCGTGCAGCAGGTGCTGGG - Intronic
1148338847 17:46861180-46861202 CAGGACATGCACCAAGTGCAGGG - Intronic
1148733601 17:49852057-49852079 CAGGAGATAAAGCAGGGGCAGGG + Intergenic
1148774415 17:50087644-50087666 CAGGACAAACAGCAGGTGCCTGG + Intronic
1149875929 17:60233064-60233086 AAGGTCATAAAGCAAGTGCAAGG + Intronic
1151299876 17:73216311-73216333 CTGGGCAGACAGCAGGTGTTTGG + Intronic
1152037253 17:77881025-77881047 CTTGGCACACAGTAGGTGCACGG + Intergenic
1152094296 17:78264015-78264037 CAGGGCGCACAGCAGGTGTTCGG - Intergenic
1152143054 17:78549841-78549863 CAGGGGCCGCAGCAGGTGCAGGG - Intronic
1152879949 17:82808910-82808932 GAGGGGATAAGGCAGGTGCAGGG + Intronic
1153166701 18:2269739-2269761 CAAGTCACACAGCTGGTGCATGG + Intergenic
1154095696 18:11413226-11413248 CAGGCCTTGCAGCAGGTGCTGGG - Intergenic
1155341611 18:24819352-24819374 CAGTGCAAACAGCCCGTGCAGGG + Intergenic
1157880425 18:51316426-51316448 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1158173222 18:54622618-54622640 CAGGCAAGAGAGCAGGTGCAGGG + Intergenic
1159109698 18:64042615-64042637 CAGGCAAAACAGCACGTGCAGGG + Intergenic
1161058310 19:2201413-2201435 CAGGGAAGACAGCAGGAGCGAGG - Intronic
1161335048 19:3708516-3708538 CTGGGCAGGCAGCAGGTGCCAGG - Intronic
1161588579 19:5118458-5118480 CAGGGCTTAGGGCAGCTGCAGGG + Intronic
1161790667 19:6357984-6358006 CAGGGCAGGCAGGGGGTGCAGGG + Intergenic
1161979034 19:7621014-7621036 CTGTGCGTACAGCAGGTACAAGG + Exonic
1162152356 19:8655458-8655480 CTGGGCAGACACCAGGTGCGGGG + Intergenic
1162265844 19:9573546-9573568 GAGGGAATGCAGCAAGTGCAAGG + Intronic
1162936343 19:13983496-13983518 CAGGTGGTTCAGCAGGTGCAGGG - Exonic
1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG + Intronic
1163749087 19:19064672-19064694 CAGGGCAGAGGGCAGGTGCCAGG - Intronic
1165312769 19:35038995-35039017 CAGTGCATACACCAGGCCCAGGG + Intronic
1165708321 19:37991899-37991921 CAGGTCATGCAGCTAGTGCAGGG - Intronic
1165821508 19:38679311-38679333 CCGGGCACACTGGAGGTGCATGG - Intronic
1166043491 19:40216613-40216635 GAGGGATTACAACAGGTGCAGGG - Intronic
1166060153 19:40320916-40320938 CAGGGCTTGCAGCAGGGACATGG + Exonic
1166740633 19:45112805-45112827 CGGGGCACAGAGCAGGTGCTGGG + Intronic
1167214662 19:48156543-48156565 CAGGTCATACAGCCAGTGGATGG + Intronic
1167586260 19:50377349-50377371 CGGGGCCTACAGCAGGGGCGGGG + Intronic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
1167855855 19:52239223-52239245 CAGGGCATTCTGCACGTGAAAGG + Intergenic
1168373774 19:55858568-55858590 CAGGGCCTTCAGCTGGTGCTGGG - Exonic
1202700129 1_KI270712v1_random:158028-158050 CCTGGCATACAGCAGGTGCCTGG - Intergenic
925144841 2:1574324-1574346 CAGGGCAGACAGGCGGTGAAGGG + Intergenic
925298618 2:2794474-2794496 CAGGGCAGAGAGCATCTGCAGGG - Intergenic
926636136 2:15181848-15181870 CAGGGCCTACAGCAGGAACTAGG + Intronic
926731761 2:16040978-16041000 CGGGTCATGCAGCAGGTTCATGG + Intergenic
926862329 2:17322145-17322167 CAGGCAAGACAGCATGTGCAGGG - Intergenic
927105459 2:19819774-19819796 CAGGGCATACTGCATGGACAGGG + Intergenic
927511037 2:23643735-23643757 CACTGCATCCAGCAGGAGCAGGG - Intronic
927692060 2:25215504-25215526 CAGGGCAGACTGAAGCTGCAAGG - Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
929279780 2:40065211-40065233 CAGGTCACACAGCAGATGAATGG + Intergenic
929821160 2:45274817-45274839 CAGCTCAGACAGCAGGTGGAAGG + Intergenic
931083630 2:58804285-58804307 CAGGCAAGACAGCATGTGCAAGG + Intergenic
932371413 2:71191764-71191786 CAGGGCATATATCAGCTGCGTGG - Intronic
934171062 2:89541503-89541525 CCTGGCATACAGCAGGTGCCTGG - Intergenic
934281367 2:91615821-91615843 CCTGGCATACAGCAGGTGCCTGG - Intergenic
934460390 2:94211391-94211413 CAGGGCATGCAGCGTTTGCATGG + Intergenic
934744986 2:96753451-96753473 CAGTGCATTCAGCAGGTAGAGGG + Intergenic
937065010 2:119011348-119011370 CATGGCACACAGAAGGTGCTTGG + Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
939254202 2:139721586-139721608 CAAGGCAGAGACCAGGTGCAAGG - Intergenic
940392999 2:153154281-153154303 CAGGCAAGACAGCATGTGCAGGG - Intergenic
940631927 2:156250988-156251010 CAGGCAAGACAGCATGTGCAGGG - Intergenic
940892864 2:159051997-159052019 TAGGGCATACAGCTGGGGAATGG + Intronic
941812366 2:169767816-169767838 CAGGTAGTACAGCAGCTGCATGG + Intronic
943998212 2:194798017-194798039 CAGGCAAGACAGCATGTGCAGGG - Intergenic
944384477 2:199149370-199149392 CAGGCAAGACAGCATGTGCAGGG - Intergenic
944917685 2:204377858-204377880 CAGGCAAGACAGCATGTGCAGGG - Intergenic
945121109 2:206458236-206458258 CCTGGCATACAGGAGGTACATGG + Intronic
946969893 2:225079923-225079945 CAGGGCAAACAGTTTGTGCAAGG - Intergenic
946992465 2:225350708-225350730 TAAGGCATACAGCAAATGCAAGG - Intergenic
948022552 2:234748001-234748023 CAGGCAAGACAGCATGTGCAGGG + Intergenic
948409563 2:237748656-237748678 CAGAGCATCCAGGAGGTGCCTGG + Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1168956611 20:1838682-1838704 CAGGTCATAAAGCAGGGGGATGG - Intergenic
1168962491 20:1878871-1878893 CAGGGCACCTAGCAGGTGCTGGG - Intergenic
1170075831 20:12417735-12417757 CAGTGCAGACAGCAGGGGCTGGG - Intergenic
1171225690 20:23440293-23440315 CAGGGCAATCAGCAGCAGCAGGG - Exonic
1171448593 20:25221319-25221341 CAGGGCAGAAAGCAGGTACGGGG + Exonic
1171720486 20:28557600-28557622 CAGGGAATACAGATTGTGCATGG - Intergenic
1171784803 20:29453049-29453071 CAGGGAATACAGATTGTGCATGG - Intergenic
1171863585 20:30424590-30424612 CAGGGAATACAGATTGTGCATGG + Intergenic
1172106296 20:32519084-32519106 CAGGACACACAGCAGCTGAATGG + Intronic
1172185286 20:33027625-33027647 AAGGTCATACAGCAAGTGAATGG - Intergenic
1172215878 20:33235311-33235333 CCAGGCATACAGCAGGAGCTCGG + Intergenic
1172293484 20:33792074-33792096 AAGGTCACACAGCAAGTGCATGG - Exonic
1172636649 20:36414562-36414584 AAGGTCACACAGCAGGTGGAGGG - Intronic
1172656293 20:36540862-36540884 TTGGGCAGACAGGAGGTGCAGGG - Intergenic
1172869432 20:38126606-38126628 CCGGCTATACAGCAGGGGCAGGG - Intronic
1173225530 20:41160355-41160377 CAGGGCACACAGCATGTGGCTGG - Intronic
1173810364 20:45951693-45951715 CAGGCCACACAGCAGGTGAGCGG - Intronic
1173943976 20:46935312-46935334 CAGGTCACACAGCCAGTGCATGG - Intronic
1174286742 20:49479461-49479483 CAGCGGAAACAGCAAGTGCAAGG + Intronic
1174596448 20:51688041-51688063 GAGGTCACACAGCAGGTGAAAGG - Intronic
1174963094 20:55180212-55180234 CAATGCATACAGCCGCTGCAGGG + Intergenic
1175412203 20:58777739-58777761 CAGGGCAGGCAGCAGGGGCCAGG - Intergenic
1175467305 20:59198077-59198099 CCAGGCACACAGCAGGTACATGG - Intronic
1175790624 20:61737982-61738004 CAGCGCATGCAGCGGGTGCTGGG + Intronic
1175820360 20:61905801-61905823 AAGGGAATTCAGAAGGTGCAGGG + Intronic
1176147762 20:63573046-63573068 CAGGGCACACAGCCGGGCCAGGG + Intronic
1177295390 21:19166770-19166792 AAGGGCATCCAGCTGGTGCTGGG + Intergenic
1177861161 21:26455972-26455994 CAGAGAATACAGCAGGCCCATGG - Intergenic
1178635163 21:34296141-34296163 CTGGGCATACAGCAGGTGGTAGG + Intergenic
1179447225 21:41440795-41440817 TAGGGCCTAAAGCAAGTGCAAGG + Intronic
1179791606 21:43759212-43759234 CAGAGCCCACAGTAGGTGCACGG + Exonic
1180072690 21:45444256-45444278 CTGGGCTTGCAGCAGGAGCACGG + Intronic
1181553309 22:23653245-23653267 CAGAGCCTACAGCCGGGGCATGG - Intergenic
1181728245 22:24826531-24826553 CTGGCCACACAGCAGGTGCTCGG - Intronic
1181778150 22:25174652-25174674 CAAGACACACAGCAGGTGTATGG - Intronic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182353605 22:29712330-29712352 CAGAGCACACAGCAAGTGCAAGG + Intergenic
1182455643 22:30448452-30448474 CAGGCCAAACCCCAGGTGCAGGG + Intronic
1183020055 22:35019554-35019576 CAGGTCACACAGCAGGGCCAGGG + Intergenic
1183281404 22:36934638-36934660 CAGTGCACGCAGCAAGTGCAGGG - Intronic
1183492829 22:38125942-38125964 CTAGGTATACAGCAGGTGCTGGG + Intronic
1183598575 22:38826841-38826863 CTGGGCATGCAGCAGGTGCCTGG - Intronic
1184268653 22:43364717-43364739 AGGGGCATACAGCAGGGTCAGGG + Intergenic
1184368265 22:44066575-44066597 CCTGGCACACAGTAGGTGCACGG + Intronic
1184406586 22:44304080-44304102 CAGGGCCCAGAGCAGGTGCCAGG - Intronic
1185377169 22:50487935-50487957 CAGCCCATCCAGCAGGTCCACGG - Exonic
1185402461 22:50626017-50626039 CAGGGTAGGCAGCAGGTCCAGGG + Exonic
949146187 3:702299-702321 CAGTGCAAACAGCATGTGGAAGG - Intergenic
950126898 3:10515085-10515107 CAGAGCATAGAGCAGGGGCTTGG + Intronic
950184300 3:10935590-10935612 CAGGAGATACAGCAGGTAGACGG - Intronic
950423198 3:12910637-12910659 CAGGGCATACAGGGAGTGCAGGG + Intronic
950544351 3:13629791-13629813 GAGGGCAGGCAGCAGGTACAGGG - Intronic
950681134 3:14585858-14585880 CAGAGGGGACAGCAGGTGCAAGG + Intergenic
951183285 3:19683328-19683350 CAGGCAAGACAGCATGTGCAGGG + Intergenic
952410866 3:33048674-33048696 CAGGGCAAAAAGCAGCTTCAGGG + Intronic
953691066 3:45120075-45120097 GATGTCATTCAGCAGGTGCATGG - Intronic
953768381 3:45761025-45761047 CAGGACATGCAGCAGGTCCCAGG - Intronic
953824747 3:46241425-46241447 CAGCACATACAGCAGGCACATGG + Intronic
954626159 3:52023017-52023039 CAGGGCAGACAGGAGCTGCAGGG - Intergenic
954660461 3:52224274-52224296 CAGGAGAGACAGCGGGTGCAGGG + Exonic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
956287779 3:67628685-67628707 CAGGCAAGACAGCATGTGCAGGG - Intronic
956569050 3:70673475-70673497 CAGGCAAGACAGCATGTGCAGGG + Intergenic
957199062 3:77108649-77108671 CAGGGCATACTGCAGGAGTGAGG + Intronic
959584725 3:108015422-108015444 CAGGGCATGCAGGAGGGGCATGG - Intergenic
961244559 3:125440341-125440363 CAGGGCATACAGCAGGTCTGAGG + Intergenic
961918465 3:130401511-130401533 CAGGGCATCCAGTATGTGGATGG - Intronic
962875238 3:139530975-139530997 CAGGGCAGGCAGCAGGGACAAGG + Intronic
965689737 3:171342941-171342963 CAGGCAAGAGAGCAGGTGCAGGG - Intronic
966828198 3:183983177-183983199 CAGGGCATTCTGCAGGAGCTAGG + Intronic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
968382688 4:109185-109207 CAGAAAACACAGCAGGTGCAGGG - Intergenic
968864276 4:3197858-3197880 CAGGCCACAGAGCACGTGCAGGG - Intronic
968942411 4:3645723-3645745 CAGAGCAGACGTCAGGTGCAGGG + Intergenic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
969101259 4:4769900-4769922 AAGGGCACACAGCTGGTACATGG - Intergenic
969330163 4:6470265-6470287 CCCGGCATGCAGCAGGTGCTCGG + Intronic
969354388 4:6616807-6616829 CAAGGCATACAGCTGGTGCGCGG - Intronic
969377250 4:6771144-6771166 CTGGGCATACAGCAAGAACATGG + Intergenic
969401596 4:6959292-6959314 CAGGCCCTGCAGCAGGTGCTGGG + Intronic
969966389 4:11001099-11001121 CAGGGCCTACAGCAGGGCCCAGG + Intergenic
970096737 4:12472107-12472129 CCAGGCACAGAGCAGGTGCAAGG - Intergenic
970155907 4:13141635-13141657 CAGGTAAGACAGCATGTGCAGGG + Intergenic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
973922654 4:55704557-55704579 CAGGGCAAACAGCAAGGACAAGG + Intergenic
974925305 4:68291450-68291472 CAGGCAAAACAGCATGTGCAGGG + Intergenic
975174591 4:71273192-71273214 AAGGGCATTCAGCAGGTAAATGG + Intronic
977178274 4:93840921-93840943 CAGGGAACACAGCAGAGGCAGGG + Intergenic
980723272 4:136724140-136724162 CAGGGTATACACTAGGTACAAGG + Intergenic
982227569 4:153180436-153180458 CAGGGCACACAGCCTGTGAAAGG + Intronic
984318452 4:178160530-178160552 CAGGCAAGACAGCATGTGCAGGG + Intergenic
986269318 5:6217492-6217514 CAGTGCATACAGCGGGTGCATGG - Intergenic
986308856 5:6536334-6536356 CAGGGAAAACAGCAGGTCCAGGG - Intergenic
988358975 5:30211345-30211367 CAGGCAATAGAGCATGTGCAGGG - Intergenic
988691594 5:33577872-33577894 CATGGCATACAGAATGTGGAGGG - Intronic
989088771 5:37706538-37706560 CAGGCAAGAGAGCAGGTGCAGGG - Intronic
989782852 5:45290128-45290150 CAGGCAAGACAGCATGTGCAGGG - Intronic
991021079 5:61980755-61980777 GAGGGCAGGTAGCAGGTGCATGG + Intergenic
991259075 5:64647522-64647544 CAGAGCAGACAGCAGGTGACAGG - Intergenic
992406041 5:76458895-76458917 CAGAGCATGCAGCCTGTGCAGGG + Intronic
993116192 5:83722358-83722380 CAGGGCGTCCTGGAGGTGCAAGG + Intergenic
993200933 5:84813800-84813822 CAGGAAAGACAGCATGTGCAGGG - Intergenic
993307403 5:86289767-86289789 CAGGGCCTACAGCAGGTGCAAGG - Intergenic
994315318 5:98326386-98326408 CAGGCAAGACAGCATGTGCAGGG + Intergenic
996077310 5:119211820-119211842 AAGGTCATACAGCAGATCCATGG - Intronic
996150815 5:120032554-120032576 CAGGCCAGAGAGCATGTGCAGGG + Intergenic
996458272 5:123710012-123710034 CATGCCATACAGCAGTTCCATGG - Intergenic
997334843 5:133099951-133099973 CAGGGAATGCAGCTGGAGCAGGG + Intronic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
997735768 5:136211593-136211615 CTGGGCATACTGCATATGCAGGG - Intergenic
999718248 5:154379442-154379464 CAGGGCAGCCAGCAGCTGCCTGG - Intronic
1000112739 5:158124605-158124627 CAAGGCATACTGCAGATGTATGG + Intergenic
1001580471 5:172794693-172794715 CAGGACATCCAGCTGGTGCCAGG + Intergenic
1001759511 5:174195538-174195560 AGGGGCACACAGCATGTGCATGG + Intronic
1001847802 5:174937286-174937308 CATGGCAAACAGCAGGTGCTGGG + Intergenic
1001977309 5:176010428-176010450 CAGGACATGCAGCAGGAGTATGG - Intronic
1002181247 5:177432174-177432196 CAGGGCAAGCAGCAGGTGTGGGG - Intronic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1002240117 5:177833352-177833374 CAGGACATGCAGCAGGAGTATGG + Intergenic
1002296418 5:178233513-178233535 CTGGGACTGCAGCAGGTGCAGGG + Intergenic
1002915705 6:1526226-1526248 TAGGGGATAAAGCAGATGCACGG + Intergenic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003978239 6:11364531-11364553 AAGGCCACACAGCAGGTACATGG + Intronic
1004670047 6:17787127-17787149 TAGGACATACAGCAGCTGAAGGG - Intronic
1004742156 6:18472514-18472536 CAGGTCGTACAGCAGGTGAGTGG + Intergenic
1006382095 6:33704915-33704937 CAGGACAGACAGGAGGGGCATGG + Intronic
1006632908 6:35442150-35442172 CAATGCATATAGCAGGTGCTTGG - Intergenic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1008420536 6:51294141-51294163 CATGGTATTCAGCAGGTGGATGG - Intergenic
1008640644 6:53458845-53458867 TAGAGCATTCAGCAGGAGCATGG + Intergenic
1009769011 6:68121134-68121156 CAGGGAAGAGAGCATGTGCAGGG + Intergenic
1011008703 6:82678606-82678628 AAGGGCATTCAGCAGGTTCACGG + Intergenic
1011744927 6:90400239-90400261 CAGGGCAGTCCGCAGGGGCATGG - Intergenic
1013299165 6:108786970-108786992 CAGGGCAGGCAGCAAGTCCAGGG + Intergenic
1013466108 6:110418420-110418442 CAGCACATACTGCAGGTGCTGGG + Intergenic
1013551679 6:111213794-111213816 CAGGCCACACAGCAGGTGGCTGG - Intronic
1013661907 6:112306630-112306652 CTGGGCACAGAGCAGGTGCTCGG + Intergenic
1014832741 6:126122101-126122123 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1015741295 6:136456928-136456950 CAGGGTATAAAGCTAGTGCAAGG + Intronic
1018196766 6:161362162-161362184 CATGGCATACTGCATGTGAAGGG + Intronic
1018362104 6:163081327-163081349 CAGGGACTACAGCAGGGGCATGG + Intronic
1018606790 6:165606029-165606051 CTGGGCACGCAGCAGGTGCGTGG + Intronic
1018925685 6:168205387-168205409 AAGGTCATACAGCAGGTCCGAGG - Intergenic
1018973792 6:168548200-168548222 AAGGGCATTCAGAAGGTCCAGGG - Intronic
1019575557 7:1735944-1735966 AAGGTCACACAGCAGGCGCACGG + Intronic
1019775979 7:2912508-2912530 CAGCCCATAGAGCAGGTGCTTGG + Intronic
1019875630 7:3808164-3808186 CAGAGCACACAGCAGTTGCCAGG + Intronic
1019924000 7:4180451-4180473 CAGGGCATAGAGCTGGAGCCGGG - Intronic
1020315319 7:6901571-6901593 CAGGGCATGCTACAGGGGCATGG - Intergenic
1021994277 7:26164724-26164746 CAGGACATATAGCATGGGCAAGG - Intronic
1022029470 7:26479173-26479195 CAGAACAAACAGCAAGTGCAAGG - Intergenic
1022130982 7:27404315-27404337 CAGCGAATACAGTAAGTGCAGGG + Intergenic
1022291703 7:29010933-29010955 AAGGTCATACAGCTGGTACATGG + Intronic
1023254004 7:38294951-38294973 CAGGTCACACAGCTGGTTCATGG - Intergenic
1026592413 7:71708333-71708355 CAGGGAAGAGAGCATGTGCAGGG + Intronic
1027470606 7:78568961-78568983 TAGGGCAAACAGCAAGTGAAAGG - Intronic
1029033196 7:97490498-97490520 CAGGCCATCAACCAGGTGCAGGG + Intergenic
1029049592 7:97670564-97670586 CAGAGAAGACAGCAGGTGCAAGG - Intergenic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1029710677 7:102297707-102297729 CTGGGCATACAGCAGGCGCTTGG - Intronic
1030615350 7:111732802-111732824 ATGGCCATACAACAGGTGCATGG + Intronic
1030856408 7:114563035-114563057 CAGGGAAGAGAGCATGTGCAGGG + Intronic
1032153875 7:129452717-129452739 CAGGGCATCCAGGAAGTGTAGGG + Intronic
1032615117 7:133460297-133460319 CAGGCCACACAGCAGGTGAGCGG - Intronic
1034036084 7:147823998-147824020 CAAGGCATTCAGAAGGTGTATGG + Intronic
1034529543 7:151687181-151687203 CAGGGCAGACAGCAGAGGCTGGG - Intronic
1034614997 7:152408496-152408518 CAGGCCACACAGCAGGTGAGCGG + Intronic
1034989552 7:155539463-155539485 CAGGCCAGCCAGGAGGTGCAGGG - Intergenic
1035312074 7:157975792-157975814 CAGGGCACACAGTAGGTACCTGG - Intronic
1036098178 8:5748386-5748408 GAGGAGATACAGCAGGTGTACGG + Intergenic
1037432934 8:18832774-18832796 CAGGCAAAAGAGCAGGTGCAGGG + Intronic
1037984725 8:23282703-23282725 CAGGCAAGACAGCAAGTGCAGGG - Intronic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1038186777 8:25282394-25282416 AACAGCATACAGCAGGTGAAAGG - Intronic
1038255481 8:25947279-25947301 CAGGGAAGAAAGCATGTGCAGGG - Intronic
1038667362 8:29550666-29550688 CAGGACACAGAACAGGTGCAAGG - Intergenic
1038957958 8:32487703-32487725 CAGGGCATGCAGCATCTGCTGGG + Intronic
1038958699 8:32495310-32495332 CAGGCAAGACAGCATGTGCAGGG - Intronic
1039080018 8:33724839-33724861 CAAGGCATCCAGCAAGGGCAAGG - Intergenic
1039346502 8:36711099-36711121 CAAGGCATACAGCAGAAGGAGGG - Intergenic
1039913560 8:41843504-41843526 CAGCACATACAGCAGGCACATGG + Intronic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1041455126 8:58050829-58050851 CAGGGCATACACCAGGGGGTGGG + Intronic
1041855523 8:62449336-62449358 AATGGAATACAGCAGGTGGATGG - Intronic
1042372609 8:68008783-68008805 CAGGCAAGACAGCATGTGCAGGG - Intronic
1042835340 8:73074785-73074807 GAGGGCACACAGTGGGTGCAGGG + Intronic
1043976927 8:86594337-86594359 CAGCCCATGCAGCAGGTCCACGG + Intronic
1046651079 8:116837267-116837289 CAGGACCTACAGAAGTTGCATGG + Intronic
1046823283 8:118659125-118659147 CAGGGCATGAAGTAGGTGGATGG - Intergenic
1047635468 8:126756868-126756890 CAGAGGAAACAGCACGTGCAGGG - Intergenic
1048210595 8:132451193-132451215 CAGGCAAGACAGCATGTGCAGGG - Intronic
1048295296 8:133209553-133209575 CAGGGCACACAGCTGGTGAGGGG - Intronic
1048971153 8:139645585-139645607 CAGGGCCCAGAGCAGGTGCTAGG + Intronic
1049229808 8:141476054-141476076 CAGGGCATCCAGCAGTGGCAGGG + Intergenic
1049681048 8:143918412-143918434 CTGGGCATCCAGCAGCCGCAGGG + Exonic
1050319259 9:4434243-4434265 TCTGGCATACAGCAGGTGCTTGG - Intergenic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1053377979 9:37624336-37624358 CAGGGCACACAGCAGGAGACAGG + Intronic
1054777288 9:69134360-69134382 CAAGTCCCACAGCAGGTGCAGGG + Intronic
1054890619 9:70247010-70247032 CAGGGCATAGAGCAGGTTGAGGG + Intergenic
1055325364 9:75122675-75122697 AAGGCCATAGAGCAGGTACATGG - Intronic
1055993836 9:82135977-82135999 CAGGGAAGAGAGCATGTGCAGGG + Intergenic
1056559644 9:87718973-87718995 CAGGTCACAGAGCAGGTGGAGGG - Intergenic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1057209108 9:93189930-93189952 CCGGGCACAGAGGAGGTGCATGG + Intronic
1057537329 9:95925106-95925128 CAGGTCAGCCTGCAGGTGCAAGG + Intronic
1058730220 9:107842686-107842708 CAGGCAAGACAGCATGTGCAGGG - Intergenic
1059041111 9:110816420-110816442 CAGGCCATACAGCAAGTGGTGGG + Intergenic
1059282043 9:113143269-113143291 TAGGGCACACAGCTGGTGAAGGG - Intergenic
1059320066 9:113462472-113462494 CATGGCCAACAGCAGGTGGAAGG - Intronic
1059443585 9:114324629-114324651 CTGGGCATGCAGCAGGGGCTGGG + Intronic
1059468849 9:114488280-114488302 CAGGGCGCACAGGAGGTGCTTGG + Intronic
1059499254 9:114737221-114737243 CAGGTCACACAGCAGGAGCTGGG - Intergenic
1059570286 9:115426949-115426971 CAGGGAAGAGAGCATGTGCAAGG - Intergenic
1060667264 9:125439344-125439366 CAGGTCACACAGCAGGTGGGAGG - Intronic
1061137366 9:128742587-128742609 CAGGGCATTGCACAGGTGCACGG + Exonic
1061194597 9:129100838-129100860 CAGGGCATTCACCAAGTGCAGGG + Intronic
1061542366 9:131284394-131284416 CAGGGCCCACAGCTGGTACAAGG - Intergenic
1062205730 9:135335849-135335871 CAGGGGCCAGAGCAGGTGCAGGG + Intergenic
1062352934 9:136148037-136148059 AAGGCCACACAGCAGGTGGAGGG + Intergenic
1062453752 9:136626394-136626416 CAAAGCAGACAGCAGGTGCATGG + Intergenic
1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG + Intronic
1062672939 9:137722604-137722626 CAGAGCACACCGCAGGTGCAGGG - Intronic
1203445593 Un_GL000219v1:52219-52241 CAGGGAATACAGATTGTGCATGG - Intergenic
1188725542 X:33578012-33578034 GTGGCCATGCAGCAGGTGCAAGG + Intergenic
1189881039 X:45492474-45492496 CAGGCCAGAGAGCATGTGCAGGG + Intergenic
1190320486 X:49176783-49176805 CCAGGGATACAGCAGGTGAAGGG + Intronic
1190469599 X:50764965-50764987 CAGGCAATAGAGCATGTGCAAGG + Intronic
1192508314 X:71704807-71704829 CAGGGAAGACAGCATGTGCAGGG - Intergenic
1192518382 X:71776746-71776768 CAGGGAAGACAGCATGTGCAGGG + Intergenic
1192527037 X:71855926-71855948 CAGGGAAGACAGCATGTGCACGG - Intergenic
1193049174 X:77082976-77082998 CAGGGCATACATAAGTAGCAGGG + Intergenic
1193242452 X:79187029-79187051 CAGGGCATATAGCAGGGCCAGGG - Intergenic
1193763756 X:85499496-85499518 CAGGTCAGACAGTAGCTGCAAGG + Intergenic
1195526043 X:105890634-105890656 CAGGCAAGACAGCATGTGCAAGG + Intronic
1198418842 X:136448651-136448673 CAGGCAAGACAGCATGTGCAGGG + Intergenic
1199274123 X:145922366-145922388 CAGGCAATACAGGAGGTGCTTGG + Intergenic
1199643354 X:149883311-149883333 CATGGCTGACAGAAGGTGCAGGG - Exonic
1200140657 X:153901240-153901262 CAGGGTCTCCAGCAGGTGCTGGG - Intronic
1202596606 Y:26547410-26547432 CAGGGCATACGAGAGGTGGAAGG + Intergenic