ID: 912275000

View in Genome Browser
Species Human (GRCh38)
Location 1:108246995-108247017
Sequence TTGAGCAGCTTGGAGAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912274998_912275000 1 Left 912274998 1:108246971-108246993 CCATATGATTTCTTTTCTTGTAA No data
Right 912275000 1:108246995-108247017 TTGAGCAGCTTGGAGAAAACTGG No data
912274996_912275000 30 Left 912274996 1:108246942-108246964 CCCATGTCTGCTGAAGTTTGAAT No data
Right 912275000 1:108246995-108247017 TTGAGCAGCTTGGAGAAAACTGG No data
912274997_912275000 29 Left 912274997 1:108246943-108246965 CCATGTCTGCTGAAGTTTGAATT No data
Right 912275000 1:108246995-108247017 TTGAGCAGCTTGGAGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912275000 Original CRISPR TTGAGCAGCTTGGAGAAAAC TGG Intergenic
No off target data available for this crispr