ID: 912278059

View in Genome Browser
Species Human (GRCh38)
Location 1:108281518-108281540
Sequence GGCTCCCAGTGACCCCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912278059_912278065 11 Left 912278059 1:108281518-108281540 CCTGGTTGGGGTCACTGGGAGCC No data
Right 912278065 1:108281552-108281574 GCAGAAAGACTAGCTGTCTTGGG No data
912278059_912278064 10 Left 912278059 1:108281518-108281540 CCTGGTTGGGGTCACTGGGAGCC No data
Right 912278064 1:108281551-108281573 GGCAGAAAGACTAGCTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912278059 Original CRISPR GGCTCCCAGTGACCCCAACC AGG (reversed) Intergenic
No off target data available for this crispr