ID: 912278064

View in Genome Browser
Species Human (GRCh38)
Location 1:108281551-108281573
Sequence GGCAGAAAGACTAGCTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912278057_912278064 14 Left 912278057 1:108281514-108281536 CCTGCCTGGTTGGGGTCACTGGG No data
Right 912278064 1:108281551-108281573 GGCAGAAAGACTAGCTGTCTTGG No data
912278055_912278064 15 Left 912278055 1:108281513-108281535 CCCTGCCTGGTTGGGGTCACTGG No data
Right 912278064 1:108281551-108281573 GGCAGAAAGACTAGCTGTCTTGG No data
912278059_912278064 10 Left 912278059 1:108281518-108281540 CCTGGTTGGGGTCACTGGGAGCC No data
Right 912278064 1:108281551-108281573 GGCAGAAAGACTAGCTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912278064 Original CRISPR GGCAGAAAGACTAGCTGTCT TGG Intergenic
No off target data available for this crispr