ID: 912287201

View in Genome Browser
Species Human (GRCh38)
Location 1:108381417-108381439
Sequence TTCTCCCGCCTCTGCTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2807
Summary {0: 3, 1: 0, 2: 6, 3: 199, 4: 2599}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912287201_912287204 1 Left 912287201 1:108381417-108381439 CCCAGGCAGCAGAGGCGGGAGAA 0: 3
1: 0
2: 6
3: 199
4: 2599
Right 912287204 1:108381441-108381463 CACCTGAGCCCAGGAAGTAAAGG 0: 6
1: 119
2: 1089
3: 5485
4: 19345
912287201_912287203 -8 Left 912287201 1:108381417-108381439 CCCAGGCAGCAGAGGCGGGAGAA 0: 3
1: 0
2: 6
3: 199
4: 2599
Right 912287203 1:108381432-108381454 CGGGAGAATCACCTGAGCCCAGG 0: 16
1: 741
2: 9349
3: 76698
4: 212572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912287201 Original CRISPR TTCTCCCGCCTCTGCTGCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr