ID: 912293222

View in Genome Browser
Species Human (GRCh38)
Location 1:108447356-108447378
Sequence TTGAGCAGCTTGGAGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 2, 1: 0, 2: 25, 3: 17, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912293222_912293226 30 Left 912293222 1:108447356-108447378 CCAGTTTTCTCCAAGCTGCTCAA 0: 2
1: 0
2: 25
3: 17
4: 261
Right 912293226 1:108447409-108447431 ATTCAAACTTCAGCAGACATGGG 0: 4
1: 11
2: 1
3: 20
4: 234
912293222_912293224 1 Left 912293222 1:108447356-108447378 CCAGTTTTCTCCAAGCTGCTCAA 0: 2
1: 0
2: 25
3: 17
4: 261
Right 912293224 1:108447380-108447402 TTACAAGAAAAGAAATCATACGG No data
912293222_912293225 29 Left 912293222 1:108447356-108447378 CCAGTTTTCTCCAAGCTGCTCAA 0: 2
1: 0
2: 25
3: 17
4: 261
Right 912293225 1:108447408-108447430 AATTCAAACTTCAGCAGACATGG 0: 4
1: 7
2: 2
3: 16
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912293222 Original CRISPR TTGAGCAGCTTGGAGAAAAC TGG (reversed) Intronic
900734934 1:4293546-4293568 TTGAGAAGCTTCTAGAAGACCGG - Intergenic
901936694 1:12631625-12631647 TTCAGAAGCTTGGAGACACCAGG - Intergenic
902461261 1:16578910-16578932 TTGAGCCTCTTGGAGAAAACAGG + Intronic
902462046 1:16585206-16585228 TTGAGCCTCTTGGAGAAAACAGG + Intronic
902462814 1:16591564-16591586 TTGAGCCTCTTGGAGAAAACAGG + Intronic
903158716 1:21469158-21469180 TTTAGCCTCTTGGAGAAAACAGG - Intronic
904154096 1:28468105-28468127 TGGAGTAGCTTGATGAAAACAGG + Intronic
906036601 1:42754328-42754350 CCCAGCAGCTTGCAGAAAACGGG + Intronic
907699321 1:56767930-56767952 TTGAAAAGCCTGGAGAAAAAAGG + Exonic
911440396 1:97919829-97919851 TTATGGAGCCTGGAGAAAACAGG + Intronic
912275000 1:108246995-108247017 TTGAGCAGCTTGGAGAAAACTGG + Intergenic
912286267 1:108372785-108372807 GTAAGCAGCTTGCAGAAGACTGG - Intergenic
912293222 1:108447356-108447378 TTGAGCAGCTTGGAGAAAACTGG - Intronic
912655394 1:111482088-111482110 ATGGGCAGCTTCAAGAAAACAGG - Intergenic
913440727 1:118894439-118894461 TTGAGCAGCTTTAAGCAGACTGG + Intronic
913543511 1:119844018-119844040 TTGAGCCTCTTGGAGAAAACAGG + Intergenic
913602661 1:120436958-120436980 TTGAGCCTCTTGGAGAAAACAGG - Intergenic
913603409 1:120443311-120443333 TTGAGCCTCTTGGAGAAAACAGG - Intergenic
913604158 1:120449663-120449685 TTGAGCCTCTTGGAGAAAACAGG - Intergenic
913640261 1:120806026-120806048 TTGAGCCCCTTGGAGAAAACAGG - Intronic
913641030 1:120812356-120812378 TTGAGCCTCTTGGAGAAAACAGG - Intronic
913990923 1:143610957-143610979 TTTAGCCTCTTGGAGAAAACAGG + Intergenic
914084382 1:144439546-144439568 TTGAGCCTCTTGGAGAAAACAGG + Intronic
914190392 1:145404821-145404843 TTGAGCCTCTTGGAGAAAACAGG + Intronic
914212251 1:145590603-145590625 TTGAGCCTCTTGGAGAAAATAGG + Intergenic
914277452 1:146137953-146137975 TTGAGCCTCTTGGAGAAAACAGG + Intronic
914278215 1:146144312-146144334 TTGAGCCCCTTGGAGAAAACAGG + Intronic
914363833 1:146960579-146960601 TTGAGCCTCTTGGAGAAAACAGG - Intronic
914364589 1:146966934-146966956 TTGAGCCTCTTGGAGAAAACAGG - Intronic
914365355 1:146973221-146973243 TTGAGCCTCTTGGAGAAAACAGG - Intronic
914487093 1:148120218-148120240 TTGAGCCTCTTGGAGAAAACAGG + Intronic
914487842 1:148126563-148126585 TTGAGCCTCTTGGAGAAAACAGG + Intronic
914538499 1:148588901-148588923 TTGAGCCTCTTGGAGAAAACAGG + Intronic
914539263 1:148595260-148595282 TTGAGCCCCTTGGAGAAAACAGG + Intronic
914587427 1:149075372-149075394 TTGAGCCTCTTGGAGAAAACAGG + Intronic
914588198 1:149081682-149081704 TTGAGCCTCTTGGAGAAAACAGG + Intronic
914627417 1:149476368-149476390 TTGAGCCCCTTGGAGAAAACAGG - Intergenic
915494364 1:156270815-156270837 CTGAGCAACATGGAGAAACCCGG + Intronic
915694563 1:157726321-157726343 ATGAGCAGCTTGGAAAGATCTGG + Intergenic
915909790 1:159907494-159907516 TGGAGCAGCTTAGAGAACTCAGG - Intergenic
917385871 1:174473472-174473494 TTCAGGAGCTTCCAGAAAACAGG + Intronic
918735625 1:188059080-188059102 TTCAGCAGCATGGATGAAACTGG - Intergenic
920929496 1:210373693-210373715 CTGATCAGCTTGGTGTAAACTGG - Intronic
921949346 1:220913690-220913712 TTTAGCAGCTTAAAGATAACAGG + Intergenic
923790286 1:237105910-237105932 TTGAGCAGCTTGAAGATAGCAGG + Intronic
923815036 1:237368054-237368076 GTGAGTAGCTTTGAGGAAACTGG + Intronic
924631830 1:245748041-245748063 TTGAGTAGCCTTGAGAAAAAGGG - Intergenic
1062817272 10:509753-509775 GAGAGCAGCTTGGAGAGGACGGG + Intronic
1062817284 10:509812-509834 GAGAGCAGCTTGGAGAGGACAGG + Intronic
1067659844 10:48226363-48226385 CTGAGCAGTTTGGAAAAAAGAGG - Intronic
1069906079 10:71733124-71733146 TAGAGCAGCTTGCAGAACTCAGG + Intronic
1070982745 10:80662864-80662886 TTGAGCAGCAGGGAGAAAGCTGG + Intergenic
1071359297 10:84829747-84829769 TTTAGCAGGCAGGAGAAAACTGG - Intergenic
1072817495 10:98524015-98524037 TTGGGTAGCTGGGAGAAAGCAGG - Intronic
1073003983 10:100307457-100307479 TAGAGCAGCATGGGCAAAACTGG + Intronic
1073322656 10:102625099-102625121 TTGAGCAGACTGGTGATAACTGG + Intronic
1073591289 10:104759858-104759880 TTGAGGAGCTTGTACAGAACTGG + Intronic
1074139560 10:110660006-110660028 CTGAGCAACATGGTGAAAACCGG - Intronic
1074370683 10:112898687-112898709 ATGACCAGCTTGGGGAAATCGGG + Intergenic
1076538122 10:131195916-131195938 TGGAGCTCCTTGGAGAACACAGG + Intronic
1078647247 11:13152182-13152204 TTGAGCCAGATGGAGAAAACGGG - Intergenic
1079488449 11:20960712-20960734 CTGAGCAGCATGGATAAACCAGG - Intronic
1080550411 11:33369531-33369553 ATGAGAAGCTTTGAGGAAACTGG - Intergenic
1084099750 11:66939352-66939374 TTGAGCATCTTGGAGGATTCTGG + Intronic
1084270311 11:68025994-68026016 TTGACCACCTGGGAGAGAACAGG - Exonic
1084943279 11:72625659-72625681 TTGTGGGGTTTGGAGAAAACAGG + Intronic
1086932982 11:92713411-92713433 TTGAGCACTTTAGAGAAAATGGG - Intronic
1087860657 11:103150478-103150500 TTGAGCAGCTGGGAAAATATTGG + Intronic
1090873440 11:130768200-130768222 ATCAGCTGCTTGGAGAAAATGGG - Intergenic
1091502159 12:1028748-1028770 ATGGGCAGCTAGAAGAAAACAGG - Intronic
1092729791 12:11519639-11519661 TTGACCATCTAGGGGAAAACTGG - Intergenic
1093549502 12:20390704-20390726 TTGAGCAGCTTCAAGGAGACAGG - Intronic
1093851713 12:24047226-24047248 TTGAGAGGCAGGGAGAAAACTGG + Intergenic
1095032283 12:37305323-37305345 TTGAGGAACTTGTAGTAAACGGG + Intergenic
1095764911 12:45884354-45884376 TTGAGCAGGCTGGAGTATACTGG - Intronic
1096916044 12:55034628-55034650 TGGAGCTGCTTGGAGAGAAGAGG - Intergenic
1099041738 12:77663709-77663731 CTGACCAACATGGAGAAAACTGG - Intergenic
1099293387 12:80800297-80800319 CTGACCAACATGGAGAAAACTGG + Intronic
1099650090 12:85415675-85415697 CTGAGCACCATGGTGAAAACCGG + Intergenic
1099872652 12:88368967-88368989 ATGAGCAGCTTGGGGAGAAGGGG - Intergenic
1100433742 12:94552934-94552956 TTTAGCATCTTGGGCAAAACTGG + Intergenic
1103353712 12:120303943-120303965 TTGAGCACCTGGGAGAAACTCGG + Exonic
1104302502 12:127577194-127577216 ATCAGCAGCTTAGAGAAACCAGG - Intergenic
1106114393 13:26804489-26804511 CTGACCAACATGGAGAAAACTGG - Intergenic
1107877621 13:44804652-44804674 TGGAGCAGGGTGGAGAAAAATGG - Intergenic
1108218902 13:48213242-48213264 TTGAGCAGTTAGGGGACAACGGG - Intergenic
1111689643 13:91547060-91547082 TTGAGCAACTGGGTGAACACTGG + Intronic
1113708766 13:112450697-112450719 TTGAGGAGCTGGAAGAAGACAGG - Intergenic
1113918837 13:113893201-113893223 TGGAGCAGATAGTAGAAAACTGG + Intergenic
1114163786 14:20198136-20198158 TTCAGCAGCTGGGAGAAGAAAGG + Exonic
1114846491 14:26329215-26329237 TAGATCAACTTGGAGAAAACTGG - Intergenic
1115475895 14:33812350-33812372 TTGGGCAGTTTGGAGATAAGAGG + Intergenic
1115859195 14:37665695-37665717 TTGAGCATCTTGAAGAAAAAGGG + Intronic
1116551092 14:46238788-46238810 ATGACCAGCATGTAGAAAACTGG + Intergenic
1118729595 14:68656966-68656988 TTAAGCAGCCTGGTTAAAACAGG + Intronic
1121662195 14:95643622-95643644 TTCTCCAGCTTGCAGAAAACAGG + Intergenic
1122388664 14:101365507-101365529 ATAAGCTGCTTGGAGAAAATGGG + Intergenic
1123791251 15:23722857-23722879 TTGAGCAGCATGAACAAAGCTGG - Intergenic
1124025746 15:25964044-25964066 GAGAGCAGCTTGGAGAACATAGG - Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1128446978 15:67771394-67771416 CTGAGCAGCAGGGAGAAAAGTGG + Intronic
1130193789 15:81760589-81760611 TTGAACAGCTTGGAGCCCACAGG - Intergenic
1131527722 15:93165915-93165937 ATCAGCAGCTGGGAGACAACCGG - Intergenic
1133950459 16:10386804-10386826 TTGCCAAACTTGGAGAAAACTGG - Intronic
1134806883 16:17133566-17133588 CTGAGCAGCGTGGAGAAATGGGG + Intronic
1134887538 16:17807052-17807074 CTGAGATGCTTGGAGACAACTGG - Intergenic
1137340084 16:47593047-47593069 TTGAGCAGCTTGGGCAACAGAGG + Intronic
1137576247 16:49602258-49602280 ATGAGCAGCTTGGGGAGGACTGG - Intronic
1142170139 16:88617591-88617613 TTGAATAGCTTGGAGACAGCAGG - Intronic
1142371384 16:89684851-89684873 TTGATCAGCATGTAGAAAATGGG - Intronic
1143285150 17:5783413-5783435 ATAAGCAGCATGAAGAAAACAGG + Intronic
1143336457 17:6175155-6175177 TTGAGCACCGAGGAGAAAAAAGG - Intergenic
1143626380 17:8112478-8112500 GAGGGCAGCTTGGAGAATACAGG - Intronic
1143916225 17:10295276-10295298 TTGAGCACGTTGGAGAAAGGTGG + Intergenic
1144023916 17:11261062-11261084 TTGAGCACCCTGGAGAGAAGGGG + Intronic
1144401989 17:14913871-14913893 TATAGCAGATTTGAGAAAACAGG + Intergenic
1145002763 17:19317184-19317206 TAGTGCTGCTTGGAAAAAACTGG - Intronic
1145762264 17:27432112-27432134 ATGAGAAGCTAGGCGAAAACGGG - Intergenic
1146456484 17:33013426-33013448 ATGGGCAGCTTGGGGAAAAGGGG + Exonic
1147549109 17:41425991-41426013 ATGAACAACATGGAGAAAACCGG + Intergenic
1147661604 17:42119944-42119966 TTGAGGAGAATGGAGAACACAGG + Intronic
1150283714 17:63943959-63943981 TTGATCAGCCTGGAGGAAGCGGG + Intronic
1153358993 18:4172541-4172563 TTGATCAGCTTTGAAATAACTGG - Intronic
1155005188 18:21722689-21722711 TTGACATGCTTGAAGAAAACTGG + Intronic
1155246624 18:23916742-23916764 TTTAGCAATTTGGAGATAACTGG + Intronic
1156395426 18:36695150-36695172 CTGACCAACGTGGAGAAAACCGG + Intronic
1158994518 18:62904232-62904254 TTCGGCAGTTGGGAGAAAACAGG + Intronic
1160244612 18:77146984-77147006 CTGTGCTGTTTGGAGAAAACTGG + Intergenic
1161497154 19:4592923-4592945 TTGAGTTTCTTGGGGAAAACTGG + Intergenic
1163836716 19:19579494-19579516 GTGAGCAGCTTGGGGAAGTCAGG - Intronic
1164270166 19:23665617-23665639 TTGAGTAGCTGGGATAACACAGG + Intronic
1165005863 19:32806110-32806132 TTGATCAGCTTGGAGAGCATGGG + Intronic
1167060850 19:47145190-47145212 TTGACCAACATGGAGAAACCCGG - Intronic
1168400681 19:56084699-56084721 TTAAGATGTTTGGAGAAAACAGG - Intergenic
1202677698 1_KI270711v1_random:22650-22672 TTGAGCCTCTTGGAGAAAACAGG + Intergenic
1202678476 1_KI270711v1_random:28996-29018 TTGAGCCTCTTGGAGAAAACAGG + Intergenic
925093177 2:1171707-1171729 TTGAGAAACTTGGAGAACTCTGG - Intronic
926858575 2:17283719-17283741 TTGAGAAGCATGGAGAAATGAGG + Intergenic
926905130 2:17798469-17798491 TTGAGCCACCTGGAGAATACTGG + Intronic
927745331 2:25614694-25614716 CTGAGCAGTTTAGAGAAAATTGG - Intronic
929801139 2:45104025-45104047 TTAATCAACTTAGAGAAAACAGG - Intergenic
930758998 2:55011224-55011246 GTGACCAGCTTGGACAACACAGG - Intronic
930862428 2:56088761-56088783 TTGGGCAGGGAGGAGAAAACAGG + Intergenic
931460575 2:62447109-62447131 ATCGGCAGCTTGGAGAGAACAGG - Intergenic
931982645 2:67710969-67710991 TTCAGCAGCTTTGAGAAATGAGG + Intergenic
932569115 2:72928550-72928572 TTGATCAGCCTGGAGCAACCAGG - Intronic
933790451 2:85879828-85879850 TTGAGCAGAATGGGGAACACAGG + Intronic
935154288 2:100469186-100469208 CTGACCAGCATGGTGAAAACTGG + Intergenic
937057036 2:118946797-118946819 TTGACGAGGTTGCAGAAAACTGG - Intronic
937423601 2:121778789-121778811 CAGAGCAGAATGGAGAAAACAGG - Intergenic
938152586 2:128900220-128900242 TTGAGAAGCTTGCAGAATCCTGG + Intergenic
938902253 2:135808264-135808286 TTGAGAAGCTGGGGGAAAAAAGG - Intronic
938980941 2:136526602-136526624 TTCAGCAGCTATGAGAAAAAGGG + Intergenic
940986737 2:160058596-160058618 TGGAGCATCCTGGTGAAAACTGG - Intronic
941831300 2:169963051-169963073 ACAAGCAGCTTAGAGAAAACTGG - Intronic
944304728 2:198166120-198166142 TTGGTCTGCTTGGAGAAAGCAGG - Intronic
945123895 2:206487515-206487537 GTGAGCAGCTCTGGGAAAACTGG - Intronic
945155469 2:206833097-206833119 TTGAGCTTCTTGGATAAAAGAGG + Intergenic
948044431 2:234932699-234932721 CTGAGCAGCATGGAGCAAACAGG + Intergenic
948178903 2:235964908-235964930 TGGAGCGGCTTTGTGAAAACAGG + Intronic
948606358 2:239138272-239138294 TTAAGCAGCCTGGAGACAAAGGG + Intronic
1168782800 20:508646-508668 TTCTGCAGTTTGAAGAAAACAGG - Exonic
1169247877 20:4038185-4038207 GACAGCAGCTTGGAGAAGACAGG + Intergenic
1170257095 20:14356968-14356990 GTGAGCATCTTGAACAAAACAGG + Intronic
1170437447 20:16345176-16345198 TTGAGCAGCATGGAGCCAATGGG - Intronic
1170541577 20:17394358-17394380 TTGAACCACTTGGAGAGAACTGG + Intronic
1172269929 20:33649173-33649195 TTAAGCTGTTTGCAGAAAACTGG + Exonic
1175106600 20:56619543-56619565 TTGAGCTGATTGGAAATAACTGG + Intergenic
1176193531 20:63825477-63825499 TTGTGCAGCATGGGGACAACTGG - Intronic
1178261900 21:31107280-31107302 TAGACCAGCTAGGACAAAACAGG + Intergenic
1178417621 21:32416653-32416675 TTGAACTTCTTGGAGAAAAAAGG - Intronic
1178573335 21:33761518-33761540 TTGAGCAGGGTGGAGACAGCAGG + Intronic
1179029343 21:37706531-37706553 GTCTGCATCTTGGAGAAAACAGG + Intronic
1179832811 21:44008577-44008599 ATTAACAGATTGGAGAAAACAGG - Intergenic
1182090840 22:27593770-27593792 TTGAGAAGCTTTGAGAGAAAAGG - Intergenic
1183141428 22:35944727-35944749 ATGAGCAGAGTGCAGAAAACTGG + Intronic
1183343737 22:37295754-37295776 TTTAGCAGCTTGCAGGAACCCGG - Intronic
1185038601 22:48492421-48492443 TAGTGCAGCTAGGAGGAAACTGG + Intronic
949111706 3:269407-269429 TTGGGCAGATAGGAGAAAAATGG + Intronic
949190476 3:1243824-1243846 ATGAGCAGCTTGGGGAGGACGGG + Intronic
950827148 3:15835751-15835773 TTGAGAAGATGGGAGTAAACTGG + Intronic
951137080 3:19117251-19117273 TTGCTCAACATGGAGAAAACTGG + Intergenic
951740288 3:25914028-25914050 TTGAGTAACTTGGAGACACCTGG + Intergenic
951846294 3:27088226-27088248 TTTAGCAGCATGGAGATCACTGG + Intergenic
952238780 3:31508200-31508222 TTGAGCCACTTTGAGAAAAATGG - Intergenic
952731352 3:36639804-36639826 GTGAGAGGCTTGGAGAAGACCGG + Intergenic
953070838 3:39517952-39517974 TTGAGGAGAGGGGAGAAAACAGG + Intronic
953522584 3:43657146-43657168 TAGAGCTCCTTGGAGAAGACAGG - Intronic
956836303 3:73099029-73099051 TAGAGCAGGGTAGAGAAAACAGG + Intergenic
957614662 3:82511085-82511107 TTCAGCAACTAGGAGAAAAATGG - Intergenic
957635394 3:82777536-82777558 TCCAGCATCTTGGATAAAACTGG + Intergenic
958523810 3:95226430-95226452 TGGAGCAACTTGCAGAAAAGGGG - Intergenic
958588082 3:96117483-96117505 ATGAGCAGCTTGTTGCAAACTGG + Intergenic
960840863 3:121957295-121957317 TTGTGCAACTTGGATAGAACGGG + Intergenic
961435086 3:126911414-126911436 ATGAGCAGCTTTGTGAACACAGG + Intronic
962255131 3:133865337-133865359 TGGAACAGCTGAGAGAAAACAGG + Intronic
962841424 3:139236147-139236169 TTGGGCTGCTTGTAGAAAATGGG + Intronic
963316024 3:143759651-143759673 CAGAGCAGCTTGAAAAAAACGGG - Intronic
963496929 3:146076241-146076263 TTCAGCAACATGGAGAGAACTGG - Intronic
963873162 3:150441873-150441895 TTGAGCACCTTAGAGCATACAGG - Intronic
963931543 3:151008979-151009001 CTGAGCAGCATGGGGAACACTGG - Intergenic
964022333 3:152028146-152028168 TTCAGCAACTTGGATAGAACTGG + Intergenic
964549943 3:157874753-157874775 TTTAGCAGCATGGAGAAAAAGGG + Intergenic
964709105 3:159652856-159652878 TTCAGCAACATGGATAAAACTGG + Intronic
965290380 3:166871145-166871167 TGCAGCAACTTGGATAAAACTGG + Intergenic
965716294 3:171606976-171606998 TTGATAATGTTGGAGAAAACTGG - Intronic
965776294 3:172235080-172235102 TTGACCAGTTTTGAAAAAACTGG - Intronic
965833725 3:172828279-172828301 TTGTTCAGTTTGGGGAAAACTGG - Intergenic
969069716 4:4526001-4526023 CAGAGCAGCATGGTGAAAACTGG + Intronic
969250829 4:5967621-5967643 TTGAGCATCCTGGAGAGAAGAGG - Intronic
971227365 4:24767221-24767243 TTGAGCACCGTTGAGAAAGCTGG - Intergenic
971779248 4:31009936-31009958 TTGGGGAGCTTAGATAAAACTGG + Intronic
971847478 4:31938855-31938877 TTGAACTGCTTGGAGAGAAGAGG - Intergenic
975361180 4:73474245-73474267 CAGAACAGCATGGAGAAAACTGG + Intergenic
977372389 4:96155562-96155584 TTGAGCAGATTGTGCAAAACTGG - Intergenic
980631073 4:135434339-135434361 TTTAGCAGCTTTGAAAAAAAAGG + Intergenic
982682826 4:158452487-158452509 CTAAGCAGCTTGAAGAAAATAGG - Intronic
983294954 4:165855220-165855242 TTAATCAGCTTGGAAAAAAATGG - Intergenic
983364518 4:166768894-166768916 AAGAGAAGCTTGGAGAAAAAAGG - Intronic
983498480 4:168472325-168472347 TGGAGCAGCTTGGAGATGATGGG - Intronic
984373630 4:178899343-178899365 TTAAGCAGTCTGGAGAACACAGG - Intergenic
984802758 4:183729858-183729880 TTGAGGTGGTTGGAGAAAGCAGG + Intergenic
986551183 5:8957723-8957745 CTGACCAACATGGAGAAAACCGG - Intergenic
987733058 5:21802257-21802279 TAGAGCGGCTTGCTGAAAACCGG + Exonic
988376874 5:30447853-30447875 TTGAGGAGTTTGGAGGAAAATGG - Intergenic
989039716 5:37215237-37215259 CTGACCAACATGGAGAAAACTGG - Intronic
989254935 5:39356244-39356266 TTGAACAGTTAGTAGAAAACTGG + Intronic
989415234 5:41167418-41167440 TTGAGCAGCTGGGAGAATGGGGG + Intronic
990277482 5:54213557-54213579 TTTAGCAGTTTGAGGAAAACAGG + Intronic
991443924 5:66680032-66680054 ATGAGCAGCTTGAAGAAAAAAGG + Intronic
993194804 5:84727938-84727960 GTGAACATCTTGCAGAAAACAGG + Intergenic
993306316 5:86279543-86279565 GTAAGCAGCTTGCAGAAGACTGG - Intergenic
995196280 5:109372713-109372735 CTAAGCAACATGGAGAAAACTGG + Intronic
995259989 5:110092496-110092518 TAGAGAACCTGGGAGAAAACTGG - Intergenic
995299328 5:110558951-110558973 TTGAGCAGCTGGGAGGAAGCTGG - Intronic
996348793 5:122515878-122515900 TTCAGCAGCATAGAGACAACAGG + Intergenic
996410229 5:123151139-123151161 CTCAGCTGCTTGGCGAAAACTGG + Intronic
997207922 5:132060869-132060891 GTGAGTAGCTTGGATAAGACTGG + Intronic
997363258 5:133308883-133308905 TTGAGCAGCTAGCAGATAAAGGG - Intronic
998115533 5:139534240-139534262 CTGACCAACATGGAGAAAACCGG + Intronic
999001643 5:147930126-147930148 TGAAGCAGCATGGAGAAAACCGG - Intergenic
1000240151 5:159401643-159401665 TTGAGCAGATGGGAGGAAAAAGG - Intergenic
1002270461 5:178068462-178068484 TGGAGCAGCTTGCAGACAGCTGG + Intergenic
1002360010 5:178662812-178662834 ATGAGCATCTCGGAGAAAAAAGG + Intergenic
1003079314 6:3008225-3008247 TTGACCAACATGGAGAAACCCGG + Intronic
1003404619 6:5818051-5818073 TTCAGCACCATGGAGAAGACTGG - Intergenic
1004670552 6:17792402-17792424 TTCATCAGTTTGGAGAAAAGGGG + Intronic
1005805826 6:29473603-29473625 TGAAACAGCTTGGAGAAACCAGG + Intergenic
1006429352 6:33985536-33985558 GTGAGCAACTTGGAGAGCACAGG + Intergenic
1007895446 6:45351670-45351692 TTGATCAATTTGGAGAAAAATGG - Intronic
1007942147 6:45791483-45791505 TTAAGCAGCCTGGAAAAAACAGG - Intergenic
1008966178 6:57315087-57315109 ATGACCAGCTCAGAGAAAACTGG - Intronic
1010212257 6:73371410-73371432 CTGACCAACATGGAGAAAACCGG + Intronic
1010882132 6:81190586-81190608 TGCAGCAGCATGGATAAAACTGG + Intergenic
1013227483 6:108130605-108130627 TTCACTAGCTGGGAGAAAACTGG - Intronic
1014272292 6:119348857-119348879 CTGAGCAGCTTGGAGGAGTCTGG + Exonic
1015388736 6:132655924-132655946 TTGAGCAGCTTGAAAAACAGAGG + Intergenic
1018471898 6:164104976-164104998 TTGAGCAGCTTGGGGGACACTGG + Intergenic
1018862634 6:167722194-167722216 TTGGGCGGCTGGGAGAGAACCGG + Intergenic
1021053903 7:16022917-16022939 ATGAGCAGTGAGGAGAAAACTGG + Intergenic
1021300581 7:18967970-18967992 CTGACCAACTTGGAGAAACCCGG + Intronic
1023485546 7:40682336-40682358 TTGAGCAGCTCAGAGAAGTCTGG - Intronic
1023696900 7:42856982-42857004 GAGAGCCGCTTGGAAAAAACTGG + Intergenic
1026353523 7:69538002-69538024 TTGAGAATCTTGGAGAAAAGAGG - Intergenic
1027158130 7:75782918-75782940 AGGAGCAGCCTGGAGAAAAGGGG - Intronic
1028453295 7:91010339-91010361 TAGATCAGTTTGGAGATAACTGG + Intronic
1030108158 7:106004424-106004446 TACAGAAACTTGGAGAAAACTGG - Intronic
1030282352 7:107790111-107790133 TTGAGCAACTTTGAGGAAATAGG - Intronic
1031153109 7:118077014-118077036 ATGAGGAGCTTGGGGAAAGCTGG + Intergenic
1031304044 7:120101761-120101783 TAGAGCAGCTTGCAGAACTCAGG + Intergenic
1032812412 7:135433909-135433931 TTTAGCAGCTAGGACCAAACGGG + Intronic
1033260893 7:139843113-139843135 CTGTGCAGCTTGGAGGGAACAGG - Intronic
1034721645 7:153299406-153299428 CTGAGCAGCAGGGAGAAACCAGG + Intergenic
1036240423 8:7076054-7076076 CTGACCAGCATGGAGAAAAAAGG - Intergenic
1037376099 8:18230826-18230848 TGGAGCAGCATGGATAGAACAGG + Intergenic
1038087146 8:24211265-24211287 AAGAACAGCATGGAGAAAACTGG - Intergenic
1040303810 8:46201844-46201866 TTAAGAAGCATTGAGAAAACAGG + Intergenic
1042610699 8:70597262-70597284 TTAAGAAGCTTGGAAAACACTGG + Intronic
1043113716 8:76221038-76221060 TAGAGTAGGTAGGAGAAAACAGG - Intergenic
1043455812 8:80411093-80411115 TTGCCCAGCTTGGAGTAAAGTGG + Intergenic
1045300635 8:100907614-100907636 CCGAGAAGCTTGGAGACAACAGG + Intergenic
1047985334 8:130227290-130227312 TTGCGCAGGTTGGAGCACACTGG + Intronic
1054234932 9:62548251-62548273 TTGAGAAACTGGGAGAAAATGGG + Intergenic
1056474576 9:86941422-86941444 TTGAGTAGCTGGGAGAAACAGGG + Intergenic
1057214462 9:93220323-93220345 TTGGGCAGCATGGACAGAACAGG - Intronic
1058386614 9:104444014-104444036 TTCAGCATCTTGGTGAACACAGG + Intergenic
1058892537 9:109373312-109373334 GTGACCAGATTGGAGGAAACTGG + Intergenic
1059826493 9:118035447-118035469 TAGAGCAGCTTGCAGAACTCAGG + Intergenic
1061109209 9:128555404-128555426 TTGACGAGCATGCAGAAAACGGG + Intronic
1061349023 9:130049196-130049218 TTGAGCAACATGGAAAAACCTGG + Intergenic
1186131614 X:6472543-6472565 TTGAGCATCTTGCAGTGAACAGG - Intergenic
1186465948 X:9785249-9785271 TGGAGCTGCTTAGAGAAAAGAGG + Intronic
1186739267 X:12500087-12500109 TTGCTCAGGTTGGAGAAAAAGGG - Intronic
1187285805 X:17902705-17902727 TAGAGTAGCTAGGAGAGAACAGG + Intergenic
1188277055 X:28213225-28213247 TTGAGTAGCTTCTAGAAAATAGG + Intergenic
1190390360 X:49925180-49925202 TTTAGCCCCTTGGAGAAAACAGG + Exonic
1190393046 X:49951683-49951705 TTGAGCTGGTTGGAGAAAGATGG + Intronic
1190488675 X:50958059-50958081 TTGAGGAGCTAGGAAAAAAAAGG + Intergenic
1190911082 X:54773370-54773392 TTGAGCAACCTGGGGAAAAATGG - Intronic
1191722132 X:64240701-64240723 TTGAGGAGGTTGAAGAAAAGTGG - Intergenic
1192583405 X:72302697-72302719 TTGAGCAGAGAGGAGACAACAGG - Intronic
1192903909 X:75529114-75529136 TTCAGCAACTTGGATGAAACTGG - Intergenic
1193908526 X:87273127-87273149 TTGAGCAGCTAACAGAAAATAGG + Intergenic
1199843630 X:151675194-151675216 TTGCTCAGCTGGGAGAAAGCAGG + Intronic
1202085073 Y:21128209-21128231 AAGAGAAGCTTGGAGAAAAAAGG - Intergenic