ID: 912294153

View in Genome Browser
Species Human (GRCh38)
Location 1:108455878-108455900
Sequence TTCTCCCGCCTCTGCTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2807
Summary {0: 3, 1: 0, 2: 6, 3: 199, 4: 2599}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912294153_912294155 -8 Left 912294153 1:108455878-108455900 CCCAGGCAGCAGAGGCGGGAGAA 0: 3
1: 0
2: 6
3: 199
4: 2599
Right 912294155 1:108455893-108455915 CGGGAGAATCACCTGAGCCCAGG 0: 16
1: 741
2: 9349
3: 76698
4: 212572
912294153_912294156 1 Left 912294153 1:108455878-108455900 CCCAGGCAGCAGAGGCGGGAGAA 0: 3
1: 0
2: 6
3: 199
4: 2599
Right 912294156 1:108455902-108455924 CACCTGAGCCCAGGAAGTAAAGG 0: 6
1: 119
2: 1089
3: 5485
4: 19345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912294153 Original CRISPR TTCTCCCGCCTCTGCTGCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr