ID: 912308442

View in Genome Browser
Species Human (GRCh38)
Location 1:108595284-108595306
Sequence AAGAATAAAGAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4359
Summary {0: 1, 1: 2, 2: 52, 3: 496, 4: 3808}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912308430_912308442 28 Left 912308430 1:108595233-108595255 CCATCTCAAAAGAAAGGAATTAA 0: 1
1: 0
2: 37
3: 1075
4: 12990
Right 912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG 0: 1
1: 2
2: 52
3: 496
4: 3808
912308428_912308442 30 Left 912308428 1:108595231-108595253 CCCCATCTCAAAAGAAAGGAATT 0: 1
1: 1
2: 6
3: 177
4: 1454
Right 912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG 0: 1
1: 2
2: 52
3: 496
4: 3808
912308429_912308442 29 Left 912308429 1:108595232-108595254 CCCATCTCAAAAGAAAGGAATTA No data
Right 912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG 0: 1
1: 2
2: 52
3: 496
4: 3808

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912308442 Original CRISPR AAGAATAAAGAGAAGGAAGA AGG Intronic
Too many off-targets to display for this crispr