ID: 912309168

View in Genome Browser
Species Human (GRCh38)
Location 1:108602344-108602366
Sequence CAGCACTTCCAGAGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912309168_912309176 23 Left 912309168 1:108602344-108602366 CCATGCTCCCTCTGGAAGTGCTG No data
Right 912309176 1:108602390-108602412 GCCTAATGTCCAGCAGCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912309168 Original CRISPR CAGCACTTCCAGAGGGAGCA TGG (reversed) Intronic
No off target data available for this crispr