ID: 912310664

View in Genome Browser
Species Human (GRCh38)
Location 1:108617796-108617818
Sequence ATGAAGAAACGGCCTCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912310659_912310664 28 Left 912310659 1:108617745-108617767 CCAGTGTGATCAGAGGAGGAAAG 0: 1
1: 0
2: 3
3: 22
4: 274
Right 912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG No data
912310660_912310664 -6 Left 912310660 1:108617779-108617801 CCTGTCCTGAAAACCAAATGAAG 0: 1
1: 0
2: 2
3: 18
4: 202
Right 912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912310664 Original CRISPR ATGAAGAAACGGCCTCAGAA AGG Intronic
No off target data available for this crispr