ID: 912312501

View in Genome Browser
Species Human (GRCh38)
Location 1:108637872-108637894
Sequence GAGTGTAAACTGATGGCTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912312501_912312504 0 Left 912312501 1:108637872-108637894 CCCTGAGCCATCAGTTTACACTC 0: 1
1: 0
2: 0
3: 7
4: 146
Right 912312504 1:108637895-108637917 GAATTGTTGACTCCCCTTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 108
912312501_912312506 12 Left 912312501 1:108637872-108637894 CCCTGAGCCATCAGTTTACACTC 0: 1
1: 0
2: 0
3: 7
4: 146
Right 912312506 1:108637907-108637929 CCCCTTTGTGGTGTTTTTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912312501 Original CRISPR GAGTGTAAACTGATGGCTCA GGG (reversed) Exonic
902074720 1:13775091-13775113 GAGTCTGAACTGTTTGCTCATGG - Intronic
902112657 1:14095665-14095687 GAGTGTCAACTGAGGCCACATGG + Intergenic
903143763 1:21356454-21356476 GTGTGTAAAAGCATGGCTCATGG + Intergenic
903550067 1:24151750-24151772 GGGAGTAAACTGATGGCATAAGG + Intergenic
907709360 1:56864330-56864352 GATTGTAAAGTGATGAATCATGG + Intronic
912312501 1:108637872-108637894 GAGTGTAAACTGATGGCTCAGGG - Exonic
913099105 1:115546556-115546578 GGTTGTAGACTGATGGCTAATGG - Intergenic
915235583 1:154478325-154478347 GAGTGGTGACTGATGGCCCACGG - Intronic
918371452 1:183865534-183865556 GAGCACAAACTGATGGCTCCAGG - Intronic
919506081 1:198399037-198399059 GAGTATAAGCAAATGGCTCACGG - Intergenic
919953110 1:202384559-202384581 GAGTGGAAAGTGATTGCTAATGG + Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921316034 1:213891941-213891963 GAGTGAAAAGAGATAGCTCAAGG + Intergenic
922028507 1:221776120-221776142 TATTGGAAACTGATGGCTAATGG - Intergenic
923190996 1:231620550-231620572 GAAAGTAAACTGATGGCTGCTGG - Intronic
924519228 1:244791913-244791935 GAATGTGAACTGATATCTCATGG - Intergenic
1063222294 10:3980261-3980283 GTGAGGAAATTGATGGCTCATGG + Intergenic
1067260915 10:44690744-44690766 GGGTGAAAACTCATGGCTGATGG - Intergenic
1071673486 10:87633586-87633608 GAGTGTGAAGTGCTGTCTCATGG - Intergenic
1076578427 10:131489514-131489536 GAGTGTGAAGTGGTAGCTCATGG - Intergenic
1077585855 11:3452573-3452595 CAGTGGAAACTGTTGCCTCAGGG - Intergenic
1077734215 11:4771421-4771443 AAGTGTAAAGTGATGGCTGCTGG + Intronic
1079891055 11:26053685-26053707 GAGTGTAAACTTCTTCCTCAAGG + Intergenic
1080671032 11:34377999-34378021 GAGTGTTAAGTCATGGCTCTAGG - Intergenic
1084970415 11:72768422-72768444 GAGTGTAAAGTGAAGGGTCTTGG - Intronic
1088459354 11:110066290-110066312 GGGTGTAAAGTGATACCTCATGG - Intergenic
1089661332 11:119987778-119987800 GAGCCTAGACTGAAGGCTCAGGG + Intergenic
1091100581 11:132869127-132869149 GAGTGGAAACTGGAGCCTCAGGG + Intronic
1091621246 12:2090936-2090958 GGGTGTGAAGTGATAGCTCATGG + Intronic
1094793682 12:33945278-33945300 GAGTGATAACAGATGGATCAGGG + Intergenic
1097663703 12:62457033-62457055 TAATGCAAACTCATGGCTCATGG + Intergenic
1097799413 12:63896757-63896779 GACGGTAAAGTGATGGCTCATGG - Intronic
1098865344 12:75756159-75756181 GTGTGTAAATTAATGTCTCATGG - Intergenic
1099170345 12:79356311-79356333 GGGTGTAAACAAATGGCTAATGG - Intronic
1099610716 12:84865471-84865493 CAGTGTAAACTGTGGGCTCTAGG - Intronic
1099868394 12:88314855-88314877 ACGTGTAAACTCATGACTCAGGG + Intergenic
1100369915 12:93958878-93958900 GAATGTAAACTGATATCTCTTGG + Intergenic
1100471242 12:94895146-94895168 GGGTGCAAACTGGTGGCTCCAGG + Intergenic
1101900085 12:108785445-108785467 GCATGTAAACAGATGGCACATGG - Exonic
1105548705 13:21371535-21371557 GAGTGAGAAATGATGGCTTATGG - Intergenic
1107399873 13:40059161-40059183 GAGTTGCAACTGATGGCCCAAGG - Intergenic
1109381971 13:61574434-61574456 GAATGAAAAATGATTGCTCATGG + Intergenic
1109748306 13:66655575-66655597 GAGTGTAAAATGATTTATCAAGG + Intronic
1111504035 13:89162924-89162946 GAGTGTGAAGTGATATCTCACGG - Intergenic
1112208536 13:97349289-97349311 GAGAGTAAACTGATCACTTAAGG + Intronic
1113486508 13:110656540-110656562 GAGTGAGAAGTGATGGCCCATGG + Intronic
1115360484 14:32494974-32494996 GAATGTAAGCTGATGGCAAAGGG - Intronic
1115363577 14:32531618-32531640 GATTCTAAACTGATAGCACAAGG - Intronic
1117344551 14:54819528-54819550 GATTGCAAACTGGTGGCTCAGGG - Intergenic
1119615364 14:76095447-76095469 GGTTGCAAACTGTTGGCTCACGG + Intergenic
1122785529 14:104161705-104161727 CTGTGTAAACTGGTGTCTCACGG + Intronic
1124161422 15:27273532-27273554 AAGAGGAAGCTGATGGCTCAAGG + Intronic
1127238403 15:57082126-57082148 GAGTGTAAATAAGTGGCTCATGG + Intronic
1130441474 15:83958789-83958811 GAATGTAAAATGATAGCTGACGG + Intronic
1130556759 15:84928221-84928243 GACTGTAAAATGGAGGCTCAAGG - Intronic
1130791773 15:87162861-87162883 GGGTGGAAATTGATGCCTCATGG - Intergenic
1134639886 16:15821954-15821976 GGTTGTAAAGTGATGGCTCCTGG - Intronic
1139395657 16:66636853-66636875 GGGTGTAAACTGCTGGCCCTTGG + Intronic
1142788714 17:2246090-2246112 GATTGTAAATTGGTGGCTCATGG - Intronic
1143694309 17:8600058-8600080 GAGTGTAGAATCAGGGCTCACGG + Intronic
1145900528 17:28488021-28488043 GAGGGTAAACAGCTTGCTCAGGG - Intronic
1147343563 17:39771124-39771146 GAGTGTTAACTGATGTTTCCTGG + Intronic
1153087756 18:1307915-1307937 GAGTGTTTACTGATGGCAGAAGG + Intergenic
1156948070 18:42859251-42859273 GGGTGTGAACTGATGTCTCGTGG + Intronic
1158113342 18:53966372-53966394 GAGGCTAAAATGATGGTTCAGGG + Intergenic
1158944827 18:62438997-62439019 GAATGTAAACTGAAGGCCTACGG + Intergenic
1159278408 18:66250891-66250913 GAGTGCACACAGATGTCTCAGGG - Intergenic
1161048691 19:2150906-2150928 GAGAGTAAACTGAGGGTCCAGGG + Intronic
1166126458 19:40717809-40717831 AATTGTATACTGATGGCTCCAGG + Exonic
1166170234 19:41023273-41023295 GAGTATCAGCTGGTGGCTCAAGG + Intergenic
1166998826 19:46732950-46732972 GAGTGTCAGCTGATGGCGCTGGG - Intronic
1167497340 19:49827368-49827390 GAATGGAAATTGATGTCTCAGGG + Intronic
1168575330 19:57504304-57504326 GAGTGTAAACAGATGTCCCCAGG + Intronic
927189134 2:20504680-20504702 GTGAGTAATCTGCTGGCTCATGG - Intergenic
930922241 2:56770123-56770145 GAGTATAAAATTGTGGCTCAGGG - Intergenic
932312575 2:70755504-70755526 GAGTGTAAACTCTTGGCTCGTGG + Intronic
936645254 2:114361673-114361695 GAGTGTAAATTGGTGGAGCAAGG + Intergenic
936816463 2:116467054-116467076 GGGTGTTATCTGGTGGCTCAAGG + Intergenic
939889248 2:147716711-147716733 GGTTGCAAACTGGTGGCTCATGG - Intergenic
941940656 2:171034061-171034083 GGGTGTAAAGTGATATCTCACGG - Intronic
943116787 2:183682853-183682875 GATCGTAAACTTGTGGCTCATGG - Intergenic
943720420 2:191198438-191198460 GAGTGCACAGTGATGGCGCATGG - Intergenic
945588312 2:211695431-211695453 AAGTTTAAATTAATGGCTCAGGG - Intronic
948347911 2:237314696-237314718 GATTGCAAGCTGGTGGCTCAAGG + Intergenic
1169197233 20:3689830-3689852 GACTCTAAACTGATTGCTCGGGG - Intronic
1169473132 20:5905769-5905791 GAGTGTTGACTGAAGGCACAAGG + Intergenic
1169481923 20:5990386-5990408 GAGAGAAAATTGATGGGTCAAGG - Intronic
1170527448 20:17253918-17253940 GTGTGTAAAGTGATATCTCATGG + Intronic
1172665051 20:36593391-36593413 GAGTGTGAACGGATCGCTGAAGG + Exonic
1174557736 20:51407789-51407811 GAGTGGAAAGTGAAGGCTTAGGG - Intronic
1175168259 20:57061758-57061780 AAGGCTAAACTGATGTCTCAGGG - Intergenic
1180737554 22:18029295-18029317 GAGAGTAACCTGATGTTTCACGG + Intergenic
1181031892 22:20152332-20152354 GAGGGTTAACTGACGGCTGATGG - Intergenic
1181511556 22:23391492-23391514 GAGGGTTAACTGAGGGCTGAGGG + Intergenic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
949969550 3:9392944-9392966 TAGAGGAAACTGATGCCTCATGG - Intergenic
951571333 3:24066316-24066338 GAGTGTGAAATGATGACACAAGG - Intergenic
953267821 3:41409986-41410008 GAGTATGAACTGATATCTCATGG - Intronic
955581618 3:60429202-60429224 GAGTTTTAACTGATGCCTCCTGG - Intronic
955774116 3:62415378-62415400 GAGTGTGAACTCAGGGTTCATGG - Intronic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
960923773 3:122776116-122776138 GAATGGAAAATGATGGCTTAAGG + Intronic
961269663 3:125679784-125679806 GAGTGTAAACCTGTGGCCCATGG - Intergenic
964055526 3:152451574-152451596 GATTGCAAACTGATAGCTCAAGG + Intronic
965122811 3:164584600-164584622 AAGTGTAAACTTAAGGCTTAAGG - Intergenic
967362164 3:188643715-188643737 CATTTTAAAGTGATGGCTCAGGG - Intronic
968315302 3:197719062-197719084 GATTGTAACCTGTTGGCACATGG - Intronic
968951466 4:3696531-3696553 CAGTGTAAACTCATGGCTGCTGG + Intergenic
971054027 4:22892447-22892469 GTGTGTAAACTGAAGGTACATGG + Intergenic
972581639 4:40400280-40400302 GTGTGTGAACCTATGGCTCATGG - Intergenic
973607019 4:52598014-52598036 GATGGTAAACTGATGGGTCCTGG + Intronic
980202243 4:129670731-129670753 CAATGATAACTGATGGCTCAGGG + Intergenic
983463203 4:168052681-168052703 GTGCGTAAACTCATGGCTCTGGG - Intergenic
989359502 5:40584599-40584621 GTGTGGACACTGATGGCTGAGGG - Intergenic
989400441 5:41002345-41002367 GAGGGTAAAGCGATTGCTCAGGG + Intronic
993613511 5:90083362-90083384 GAGTTTAAACTGAAACCTCAAGG + Intergenic
997933185 5:138088822-138088844 GAGTGTAAAGCTATGGCTGAAGG - Intronic
998796257 5:145822554-145822576 GACTATAAAGTGATGGCTTATGG - Intronic
998897833 5:146818834-146818856 GAGGTTAAAGTAATGGCTCAAGG - Intronic
999149333 5:149416424-149416446 GAGGGTCCACAGATGGCTCAAGG + Intergenic
1000568279 5:162879779-162879801 GAGTTTACACAGATGTCTCATGG - Intergenic
1000599144 5:163251336-163251358 GATTTTAAATTGATGGCTTATGG - Intergenic
1003312810 6:4984128-4984150 CAGTGTAACCTGCTGGATCATGG - Intergenic
1003418090 6:5930937-5930959 GAGTGGGAAATGAAGGCTCAGGG + Intergenic
1003503275 6:6719649-6719671 CACTGTAAGCTGATGGCTTAGGG + Intergenic
1005680093 6:28198025-28198047 GTGTCTAAACTGCTGGCTGAAGG - Intergenic
1005849502 6:29810898-29810920 GAGTGTGAAATGATGGACCATGG + Intergenic
1009061338 6:58400814-58400836 CAGAGTAAACTAATGGCTCCAGG + Intergenic
1012752847 6:103184769-103184791 GAGTGTCAAGTCCTGGCTCAGGG - Intergenic
1015798598 6:137037883-137037905 GAGTGAAAATTGAAGGATCAAGG + Intronic
1017658260 6:156650182-156650204 TAGTGCAATCTGCTGGCTCAGGG + Intergenic
1018217859 6:161548234-161548256 GGCTGCAAGCTGATGGCTCAAGG - Intronic
1019647560 7:2139240-2139262 GAGAGTACATTGCTGGCTCAGGG - Intronic
1021988178 7:26117394-26117416 GACTGTCAACTGCTGGCTGAGGG + Intergenic
1022737451 7:33089371-33089393 GAGTGCAAACTGTTGGCTGTTGG + Intergenic
1023681219 7:42689792-42689814 GAGTGTGAAGTGGTGTCTCATGG - Intergenic
1033460116 7:141539276-141539298 TAATTTAAACAGATGGCTCAGGG + Intergenic
1033655690 7:143372488-143372510 GATTGTACAGAGATGGCTCAGGG + Intergenic
1034927204 7:155131674-155131696 GAGTGTCCACTGATGCCACAGGG - Intergenic
1035129041 7:156634675-156634697 GATTGTAAACCCAAGGCTCAAGG - Intergenic
1037812615 8:22095972-22095994 GAGTGGACACTGTGGGCTCAGGG - Intronic
1039687783 8:39824719-39824741 GAGTCTAAAGTGTTGGGTCATGG - Intronic
1044347795 8:91126322-91126344 GATTGCAAACTGGTGGCCCATGG + Intronic
1052683366 9:31723125-31723147 GAATGTAAAGTGAAGGCTCATGG + Intergenic
1053461692 9:38276518-38276540 GGTTGCAAACTGATGGCCCACGG - Intergenic
1053466648 9:38313311-38313333 GTGTTCAAATTGATGGCTCAGGG - Intergenic
1055139258 9:72857032-72857054 CAGTGTACACTGATGGCCCTGGG - Intergenic
1059015638 9:110512587-110512609 GAGTGGAGACTGATGCCTCTTGG - Intronic
1062236515 9:135512531-135512553 GATTGGAAATTGATTGCTCAGGG + Intergenic
1187732930 X:22274112-22274134 TTGTGTAAACTGAGGGCTCAAGG - Exonic
1188481225 X:30638796-30638818 AAGTGTAAACTGATGGTAGAAGG - Intergenic
1189445761 X:41079620-41079642 AATTGTAAACAGATTGCTCAAGG - Intergenic
1189933182 X:46036607-46036629 GAATGGAAAGTGATGGCTAATGG - Intergenic
1202581539 Y:26386707-26386729 GAGTGGAAAGTGATTGCTAATGG - Intergenic