ID: 912313336

View in Genome Browser
Species Human (GRCh38)
Location 1:108645029-108645051
Sequence CAGTGTCAGCAGTGGCAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912313336_912313341 25 Left 912313336 1:108645029-108645051 CCACATTGCCACTGCTGACACTG 0: 1
1: 0
2: 4
3: 41
4: 263
Right 912313341 1:108645077-108645099 GCTCGACACACAGTCTCCACAGG 0: 1
1: 1
2: 4
3: 25
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912313336 Original CRISPR CAGTGTCAGCAGTGGCAATG TGG (reversed) Intergenic
900350343 1:2231451-2231473 CTGTGTCAGCTGTGACAACGAGG - Intronic
901300683 1:8198116-8198138 CAGTCCCTGCAGTGGCAACGAGG - Intergenic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
903334675 1:22616927-22616949 CAGTGTCAGCAGTGGCTTCTGGG + Intergenic
903587126 1:24424652-24424674 CAGTGGCAGGAAAGGCAATGGGG + Intronic
903767224 1:25742567-25742589 CAGTGCCAGTAGGGGCAAGGAGG + Intronic
907249202 1:53126788-53126810 CAGTGGCAGAATTAGCAATGTGG + Intronic
907692674 1:56685275-56685297 CAGTGACAGTAGTAGCAATGGGG + Intronic
908070533 1:60455089-60455111 CAGTGGCAGCAGTTGCATGGAGG - Intergenic
908932548 1:69334412-69334434 CAGGATCAGCAGTGGCAGTGTGG + Intergenic
910135776 1:83967505-83967527 CAGTGTCTGCAGCTGCACTGTGG + Intronic
910366643 1:86472371-86472393 CAGTGCCTGCAGAGGAAATGAGG - Intronic
910628674 1:89335504-89335526 CATTCCCAGCAGTGGCCATGTGG + Intergenic
911853058 1:102842688-102842710 CTGTGGCAGCAGTGGCTAAGGGG + Intergenic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
914746600 1:150505886-150505908 GAGTGTCAGAAGTGGTTATGGGG - Intronic
915682497 1:157595256-157595278 CTATGTCATCAGTGGGAATGGGG + Intronic
916271855 1:162952009-162952031 CAGTGGCTGAAGTGGCCATGTGG + Intergenic
916993701 1:170273056-170273078 CAGTGTCAGTAGTAGAAGTGGGG + Intergenic
917240355 1:172941385-172941407 GAGCATGAGCAGTGGCAATGTGG + Intergenic
917858397 1:179121432-179121454 CATTGTCAGCAATGGCACTAGGG + Intronic
918428326 1:184433262-184433284 GAGTGCCAACAGTGGCACTGGGG + Intronic
919162313 1:193846450-193846472 CATTGCCAGCAAGGGCAATGTGG - Intergenic
920976156 1:210787253-210787275 CAGGGACAGCAGTGGCTGTGGGG - Intronic
921616885 1:217279263-217279285 CAGTTTCATCACTGGCAATATGG + Intergenic
922821689 1:228489027-228489049 CAGAGTCAGCAGCTGCAGTGTGG + Exonic
923665971 1:235999021-235999043 CCGTCTAAGCACTGGCAATGTGG - Intronic
1063601390 10:7484217-7484239 TGGGGTCAGCAGTGGCACTGAGG - Intergenic
1064030086 10:11877976-11877998 AAATGTCAGCAGTGCCACTGAGG - Intergenic
1064333489 10:14416384-14416406 CAGTGTTAGCTGTTTCAATGAGG - Intronic
1064618689 10:17191979-17192001 CAGTGTCAGATGAGGCAAGGTGG + Intronic
1065086540 10:22184367-22184389 CAGTGTTAGAAGTGGCAATAAGG + Intergenic
1065666977 10:28073268-28073290 TTGTGGCAGCAGTGGCAATGGGG - Intronic
1067382509 10:45787812-45787834 CAGTGACAGAAGTGGGGATGTGG - Intronic
1070468620 10:76752996-76753018 CAGTGTCAGGAGTGAGAAAGGGG + Intergenic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1071681161 10:87707049-87707071 CAGTGTCAGAAGGGGCCAAGAGG - Intronic
1072420083 10:95283320-95283342 CAGTGTCCTCATTTGCAATGTGG - Intronic
1072745540 10:97936577-97936599 GAGAGTCAGCAGGGGCCATGTGG + Intronic
1073229812 10:101959533-101959555 CAGCCTCAGCAGTGGCTATGTGG + Intronic
1073291384 10:102414936-102414958 CAGCCTCGGCAGTGGCAATGAGG - Exonic
1073390335 10:103170879-103170901 CATTTTTAGCAGTGGAAATGAGG - Intronic
1074048186 10:109858332-109858354 CAGTGCCAACAGTGGCCAGGTGG - Intergenic
1074280326 10:112045506-112045528 CAGGCCCAGCAGTGGTAATGGGG - Intergenic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1076501020 10:130936159-130936181 CAGTGTCAGCAGAGGCATATGGG - Intergenic
1077711243 11:4539221-4539243 AAGTGTCAGAACTGGCACTGGGG + Intergenic
1080740462 11:35059163-35059185 CAGTGAGAGCAGTTGCAGTGAGG + Intergenic
1081083313 11:38769332-38769354 GAGCGGCAGCAGTGGCAGTGTGG - Intergenic
1081687032 11:45049932-45049954 CAGTGTCAGCACTGAGACTGTGG + Intergenic
1083902832 11:65652028-65652050 CAGTGATAGCAGTGACAGTGGGG + Intergenic
1084108458 11:66997019-66997041 CAGTCTCAGCTGTGGCAAGAGGG + Intergenic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1084824569 11:71719842-71719864 CAATTTCAGCAGGGGAAATGGGG + Intergenic
1084840110 11:71839769-71839791 CAGTGTCCACAGTGGGAATATGG - Intergenic
1088819664 11:113446591-113446613 CTGTTTCCACAGTGGCAATGAGG + Intronic
1090217649 11:124984098-124984120 CATTGGCAGCAGTGGCATGGTGG + Intronic
1092418544 12:8311036-8311058 CAATTTCAGCAGGGGAAATGGGG - Intergenic
1093814955 12:23534485-23534507 CAACACCAGCAGTGGCAATGGGG + Exonic
1095568429 12:43653964-43653986 GAGTGTTAGCAGTGAAAATGGGG - Intergenic
1096574572 12:52544672-52544694 CATGGTCAGCGGTGGCTATGTGG - Exonic
1099525755 12:83717945-83717967 CAGGTTCACCAGTGGGAATGTGG - Intergenic
1101438428 12:104684037-104684059 AATAGTCAGCAGTGGAAATGAGG + Intronic
1102355059 12:112226944-112226966 CAGTGTCAGCAGTTACTGTGTGG - Intronic
1104917046 12:132271140-132271162 CTGCGGCAGCAGTGGCCATGTGG + Intronic
1105418102 13:20230932-20230954 TAGTCACTGCAGTGGCAATGAGG + Intronic
1108286757 13:48916335-48916357 AAGTGACAGCAGAGGTAATGGGG + Intergenic
1108487367 13:50940579-50940601 CAGTGTGAGCACTGGCTCTGAGG + Intronic
1108839396 13:54593470-54593492 CATTGGCAGCAGTGGCATGGTGG - Intergenic
1109940058 13:69349987-69350009 ATGTGACAGGAGTGGCAATGAGG + Intergenic
1110424834 13:75355114-75355136 CAGTGTCCACACTGGGAATGTGG + Intronic
1113120164 13:106917303-106917325 CAGTGGCCGCAGCGGCCATGGGG + Intergenic
1114191690 14:20444014-20444036 CAGTGGCAGCAGTGGAAGTGAGG + Intergenic
1114590585 14:23861001-23861023 CAGTGTCAGCAATGGTGATGTGG + Intergenic
1115091134 14:29577285-29577307 CAGTCTCAGGAGTGTCACTGTGG + Exonic
1117110422 14:52447287-52447309 CTGTGGTAGCAGTGGCCATGGGG + Intronic
1117756184 14:58976636-58976658 AAATGTCAGCAGTGGTAATCTGG + Intergenic
1121853963 14:97249293-97249315 AAGTCACAGCAGTGGCACTGTGG - Intergenic
1122049136 14:99043222-99043244 AGGTGTCAGCAGTGTCAACGTGG + Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123627950 15:22240157-22240179 TAGTGACAACAGTGGCACTGAGG + Intergenic
1126183829 15:45811339-45811361 CAGTGGTAGCAGTGGCTATGGGG + Intergenic
1128850888 15:70954858-70954880 CAGGGGCAGCAGGGGCACTGTGG + Intronic
1129719051 15:77867932-77867954 CAGTGGTGGCAGTGGCAGTGTGG + Intergenic
1130536689 15:84790526-84790548 CAGTATCAGCACTGGAAATGAGG + Intronic
1130726073 15:86440947-86440969 CAGTGTCAGGAGTGGACATTGGG + Intronic
1131356875 15:91752964-91752986 TAGGGTCAGGAGTGGCAAAGGGG + Intergenic
1131357070 15:91754797-91754819 CAGGGTCAGGAGTGGCAAAGGGG - Intergenic
1132257190 15:100385889-100385911 CAGTGTCAGTGGAAGCAATGTGG + Intergenic
1132413078 15:101600205-101600227 CAGTGTCAGCAGAGGCCACGTGG - Intergenic
1132533090 16:463267-463289 CAGAGTCAGCAGGTGCAGTGAGG + Intronic
1132590994 16:726422-726444 CAGTGGCAGCAGCAGCCATGGGG - Exonic
1133357972 16:5150889-5150911 CAATTTCAGCAGGGGAAATGGGG - Intergenic
1133488006 16:6239116-6239138 CAGTGTATGCTGTGGGAATGGGG - Intronic
1134097167 16:11425407-11425429 CTGAGTCAGCAGTGACACTGAGG + Exonic
1135719376 16:24802246-24802268 CTGTGTTAACAGTGACAATGAGG + Intronic
1136031321 16:27505345-27505367 AAATGTCAGCACTGGCAAGGTGG - Intronic
1136356747 16:29749003-29749025 CAGAGCCAGCAGTGGCAACTCGG + Intergenic
1136567429 16:31078742-31078764 CAGTGACAGCATTGGCAGAGTGG - Exonic
1137609891 16:49811206-49811228 CGCTATCAGCAGAGGCAATGAGG + Intronic
1137938417 16:52657807-52657829 TAGTGTTTGCAGTGGCAATGGGG - Intergenic
1138687575 16:58739066-58739088 CAATGTCAGCTGTGGAAATCAGG + Intergenic
1139395412 16:66634792-66634814 AAGTGTCAGCACTGGTAAAGTGG - Intronic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1141365206 16:83436125-83436147 AAATGTCACCAGTGGCAAGGTGG + Intronic
1141882182 16:86867413-86867435 GAGTGGGAGCAGTGGAAATGAGG - Intergenic
1143329481 17:6122612-6122634 CAATGTCAGGCGTGGCAGTGGGG + Exonic
1143917800 17:10306776-10306798 CAGTCTCAGCAGTGGCAAAGTGG - Intronic
1145102888 17:20091425-20091447 CAATGTCAGCAGTGCCACGGTGG - Intronic
1145894646 17:28447390-28447412 CAGTGTGAAAAGTGGCCATGGGG + Intergenic
1146592380 17:34138568-34138590 CAGTGACAGCATTGACCATGTGG - Intronic
1147740646 17:42669507-42669529 CAGTGTCAGCTATGGCCATGTGG - Exonic
1147773995 17:42887587-42887609 CTGCGTAAGCAGAGGCAATGCGG + Intergenic
1150533728 17:66013806-66013828 CAGTGGCAGCAGTGGCACCATGG + Intronic
1152473921 17:80505292-80505314 CAGTGTCTGGAGAGGCAGTGAGG + Intergenic
1153112582 18:1609838-1609860 CAGTCTCAGAGATGGCAATGGGG + Intergenic
1153484474 18:5582866-5582888 GAGCGTCAGCAGAGGCAGTGAGG + Intronic
1157012655 18:43670237-43670259 CATTGGCAGCAGTGGTAATATGG - Intergenic
1160289360 18:77576723-77576745 CAGTGACAACAGTGTCCATGTGG - Intergenic
1161010088 19:1955726-1955748 CGGTGACAGCAGTGGCACGGGGG - Intronic
1161265824 19:3363882-3363904 CAGTGTCCACAGTGCCAAGGGGG + Intronic
1163006307 19:14398731-14398753 CAGAGCAAGAAGTGGCAATGGGG - Intronic
1163290483 19:16376459-16376481 CATTGGCAGCACTGGCCATGGGG + Intronic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1164711423 19:30359627-30359649 CAATGTCGGCAGTGGGGATGAGG + Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1166018885 19:40006571-40006593 CAGTGACATCAGTGTCATTGTGG + Intronic
1166996174 19:46720628-46720650 CAGCGCCAGCACTGGCAATGAGG + Exonic
1167508535 19:49883748-49883770 CAGTGTCAGGGGTGGCACTTAGG + Intronic
925117194 2:1389667-1389689 CAGTGGCAGGAGTGGCTCTGGGG - Intronic
925833281 2:7917588-7917610 CAGTGACACTAGTGGAAATGTGG + Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
927526793 2:23750729-23750751 CAGTCTAGGCAGTTGCAATGAGG - Exonic
929090400 2:38210887-38210909 CAGTGTCAGCAGAGACAACATGG + Intergenic
930092836 2:47543886-47543908 CAGTGGCAGAAGTAGCTATGAGG - Intronic
930990710 2:57650672-57650694 CAGTGTAGACAGAGGCAATGGGG + Intergenic
931505589 2:62922885-62922907 AGGTGTTTGCAGTGGCAATGGGG - Intronic
931513795 2:63029213-63029235 CAGGGTCAGCAGTGTCACTGTGG - Intronic
932244589 2:70185860-70185882 AAATGTCAGCAGTGCCAAGGTGG - Intronic
933187313 2:79292233-79292255 CAGTGTTGGCTGTGGCAGTGAGG + Intronic
934219080 2:90065007-90065029 CAGTGTCAGCACAGACAAAGTGG + Intergenic
935122672 2:100196455-100196477 CAGGCCCAGCATTGGCAATGAGG - Intergenic
935603363 2:104945380-104945402 CAGTTTCAGCAGTGGAAAGCAGG + Intergenic
935790456 2:106585294-106585316 CTGAGGCAGCAGTGGCAATCAGG + Intergenic
936526076 2:113242344-113242366 CAGTGTCAGCAGGGACTGTGAGG - Intronic
938654309 2:133415117-133415139 CAGCATCAGCGGGGGCAATGGGG - Intronic
938730244 2:134141739-134141761 CATTGCCAGCAGGGGCCATGTGG + Intronic
939373836 2:141338238-141338260 CAGTGGCTTCAGTGGTAATGGGG - Intronic
939575723 2:143892722-143892744 CAGTGTCATCAGTGGGAAAAGGG + Intergenic
939957506 2:148539345-148539367 CAGTGTCAGCTGGTGCAGTGTGG - Intergenic
941145685 2:161841363-161841385 CTGTGTCAGCAGGGGCATGGTGG - Intronic
944890735 2:204114824-204114846 CACTGTGCGTAGTGGCAATGGGG + Intergenic
945547666 2:211176694-211176716 CTGTTGCAGCACTGGCAATGAGG - Intergenic
945586136 2:211665604-211665626 CATTTTCAGCAGTGCAAATGTGG + Intronic
948172806 2:235919106-235919128 CAGGGTCAGCTGTGGGAAAGAGG + Intronic
948404686 2:237708466-237708488 CAGGGTCAGCAGTGATGATGCGG - Intronic
948710106 2:239820026-239820048 CAGGGTCTGCAGGGGCAAAGGGG + Intergenic
948967123 2:241391498-241391520 CAGAGACACCAGTGGAAATGTGG - Intronic
1170589513 20:17761235-17761257 CAGGCTCAGTAGTGGCAAAGGGG + Intergenic
1170913886 20:20603628-20603650 GGCTGTCAGCAGGGGCAATGAGG - Intronic
1173050325 20:39553276-39553298 GTGTGTCAGCAATGGAAATGAGG + Intergenic
1173476846 20:43365633-43365655 CAATGTCAGTAGAGGCAAGGTGG - Intergenic
1175340135 20:58223675-58223697 AACTGTCAGCAGTGCCAAGGTGG - Intronic
1175521087 20:59603504-59603526 CAGTGTGAGCGCTGGCAGTGTGG - Intronic
1175634256 20:60567316-60567338 CAGAGTTATCAGTGGCAATGGGG + Intergenic
1177974011 21:27825208-27825230 CAGTTCCAGCAGTGGCAAGCAGG + Intergenic
1179830248 21:43992033-43992055 GAGTGTGCGCAGTGGCAAGGGGG + Intergenic
1180138760 21:45878142-45878164 CTGTGGCAGCAGTGGCTTTGAGG + Intronic
1181104281 22:20564333-20564355 CAGCGGCAGCCGTGGCAGTGGGG + Intronic
1181165570 22:20981216-20981238 CAGTGGCAGCAGAGGCCTTGAGG - Exonic
1181303875 22:21903074-21903096 CAGTGATAGCAGTGGCACTGGGG - Intergenic
1182445116 22:30385496-30385518 CAGCAGCAGCAGTGGCAACGGGG + Intronic
1183148668 22:36019192-36019214 CAGTGTCTGCAGGGGGGATGTGG - Intronic
1184111791 22:42399762-42399784 CACTGTCAGCAGTGGCCGTGTGG - Intronic
1184926324 22:47642291-47642313 CAGTGCCAGCAGAGACCATGTGG + Intergenic
949376140 3:3392510-3392532 CAGTGCCAGCACTGGGGATGGGG - Intergenic
950042342 3:9928338-9928360 CAGGGTCAGCAGTTGCAGTCGGG - Exonic
953382902 3:42487423-42487445 CAGAAGCAGCAGTGGCCATGTGG + Intergenic
953606987 3:44418756-44418778 CAGTGGCAGGAGTGGGAATTGGG - Intergenic
954796495 3:53163885-53163907 TAGTGTCAGTAGTAGCGATGGGG + Intronic
955571264 3:60309332-60309354 AAGTGTCAGAAGTGGAAATGGGG - Intronic
955894548 3:63685550-63685572 CACTGTCAGCTGTGACAAAGAGG - Intergenic
956889917 3:73602555-73602577 CTGTGTCAAGAGTGGCAATAGGG + Intronic
957062489 3:75493483-75493505 CAATTTCAGCAGGGGAAATGGGG - Intergenic
958419865 3:93917693-93917715 CCCTGCCAGCAGGGGCAATGAGG + Intronic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
959118453 3:102205848-102205870 CTGTGGCGGCAGTGGCCATGGGG - Intronic
961290910 3:125845934-125845956 CAATTTCAGCAGGGGAAATGGGG + Intergenic
961504413 3:127360733-127360755 CAGCCTCAGCAGTGTCACTGGGG - Intergenic
964968158 3:162524883-162524905 CAGTGTTAGAAGAGGCAATCTGG + Intergenic
965020055 3:163217807-163217829 CTGAGGCAGTAGTGGCAATGGGG - Intergenic
965193009 3:165555715-165555737 CAGTGTCAGCGGTAGAAATTGGG + Intergenic
968073435 3:195802355-195802377 CCGAGTCAGCAGGGGCAGTGAGG - Intronic
969057274 4:4409812-4409834 CAGTGTCAGGAGTGTCCCTGTGG + Intronic
969781200 4:9405772-9405794 CAGTGTCCACAGTGGGAATATGG - Intergenic
970055401 4:11965539-11965561 AAGTGTCCACAGTGGCTATGGGG + Intergenic
971048339 4:22831251-22831273 AGGTGTCCACAGTGGCAATGGGG - Intergenic
971753468 4:30679419-30679441 CATTGTCAGCAGTGTGAAAGTGG + Intergenic
973144137 4:46804318-46804340 CAGAGCCAGCAGTGGCAACCTGG - Intronic
975511117 4:75194415-75194437 CAGCGGCAGCAGTGGCAGTGTGG - Intergenic
975582778 4:75921744-75921766 CAGGGTGAGGAGTGGCAGTGGGG + Intronic
977755268 4:100663058-100663080 CGGTGTCTGGAGTGGCAAAGAGG - Intronic
979268841 4:118735485-118735507 AAGTGACAGAAGTGGTAATGAGG + Intronic
979823560 4:125204408-125204430 CAGAGCCAGCAGTGGCAACCTGG + Intergenic
980108573 4:128612697-128612719 CAGTTTCAGCAATCACAATGTGG - Intergenic
981309019 4:143277889-143277911 CAGTGTCAGCAGACACATTGGGG - Intergenic
981495371 4:145385769-145385791 CAGTGTCAGCAGAGACCATGTGG - Intergenic
981558720 4:146023867-146023889 CAGCCCCAGCAGTGGCCATGTGG - Intergenic
981748409 4:148072089-148072111 CAGGGTCAGCAGGGGCTCTGAGG - Exonic
982238789 4:153277903-153277925 CAGTGTGAGAAGTGGTCATGAGG - Intronic
983786718 4:171740960-171740982 CAGTGTCAGCAGTGTCATTTGGG - Intergenic
986204309 5:5609594-5609616 CAGTGGCGGGGGTGGCAATGTGG + Intergenic
986224293 5:5798897-5798919 CAGTGTGAGCAAAGGCACTGAGG + Intergenic
986973993 5:13374231-13374253 CAGCTTCAGCAGTGGCAACTGGG + Intergenic
996452054 5:123636664-123636686 CAGTGTCATCAATGACATTGCGG - Intergenic
999030726 5:148288211-148288233 CCGAGTCAGCAGGGGCAAGGAGG - Intergenic
1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG + Intronic
1000881496 5:166703254-166703276 CAGTGTCATCAGTGTCGGTGGGG + Intergenic
1001398506 5:171433220-171433242 CAGGGTCAGCAGGGGCTATCGGG - Intronic
1002963117 6:1936257-1936279 CAATGTGAGCAGTGGCAAGAGGG + Intronic
1003265979 6:4565400-4565422 CAGAGTCAGCAGGGGCCCTGGGG + Intergenic
1003750632 6:9051390-9051412 CAGATTGAGCAGTGGCAATGTGG + Intergenic
1003960132 6:11201201-11201223 CAGCGGCAGCAGAGGCCATGTGG + Intronic
1004663427 6:17729549-17729571 CGGAGTCAGCAGTGGTAATCTGG + Intergenic
1004702334 6:18091049-18091071 CAGTGTGAGCAATGGCAAGGAGG - Intergenic
1007212547 6:40206882-40206904 AAGTGTCTGCACTGGCAGTGGGG + Intergenic
1008927503 6:56902539-56902561 CAGAGTCAAAAGTAGCAATGAGG + Intronic
1009492196 6:64304861-64304883 CAGTGAAAGCAGTGGTAAGGGGG + Intronic
1009518727 6:64654772-64654794 CAGTGACAGAAGTGGCCATTTGG - Intronic
1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG + Intronic
1010177911 6:73051197-73051219 CACTGGCAGCAGTGGCAGCGTGG - Intronic
1011023769 6:82843427-82843449 CAGTGTTAGTGATGGCAATGGGG - Intergenic
1011093477 6:83633382-83633404 CAGTGTCAGCTGTGGTAGTATGG + Intronic
1011206568 6:84905524-84905546 CAGTGTTAGCAAGGGCAATGGGG + Intergenic
1011624141 6:89269918-89269940 CTGTGTCAGCTTTGGCTATGGGG - Intronic
1014473283 6:121842167-121842189 GAATGTAAGCAGTGGCAATAAGG - Intergenic
1015924329 6:138294218-138294240 GAGTGTAAGCAATGGGAATGTGG - Intronic
1016375115 6:143412378-143412400 CAGAGTCAGAAGTGGCAAAATGG - Intergenic
1016486309 6:144543436-144543458 CAGTGGCAACAGTGGCTATGGGG - Intronic
1017070662 6:150573184-150573206 CAGTGTCAGCAGGGCCAGCGGGG - Intergenic
1017444864 6:154498554-154498576 CAATGTCAGAAGTTGCAGTGTGG - Intronic
1018073737 6:160191062-160191084 TAGTGTTTGCAATGGCAATGGGG - Intronic
1018441232 6:163815278-163815300 CAGTCACTGCAGAGGCAATGAGG + Intergenic
1018907969 6:168086184-168086206 CAGTGTCCACACTGGGAATGTGG - Intergenic
1019832418 7:3346085-3346107 CAGTATCACAAGTTGCAATGTGG - Intronic
1020201813 7:6085964-6085986 CAGTGTCTGTGGTGGCATTGAGG - Intergenic
1020326921 7:6981898-6981920 CAATTTCAGCAGGGGAAATGGGG - Intergenic
1022518969 7:30993696-30993718 CTGAGTCAGCAGTGGCAACCTGG - Intergenic
1022642000 7:32195925-32195947 CAGTGTCAGTAGAGACCATGTGG - Intronic
1022817635 7:33928782-33928804 ACGTGCCAGCAGAGGCAATGGGG - Intronic
1022844737 7:34198608-34198630 CAGTCACAGCAGTGGCAAAGCGG + Intergenic
1024119767 7:46225077-46225099 CAGTGGCAGCAGTGACACTGGGG + Intergenic
1024248413 7:47488268-47488290 CAGTGTCAGCACTGGGAATGAGG - Intronic
1027606835 7:80310873-80310895 CTGTTTCAACAGTGGCAATGTGG + Intergenic
1029861328 7:103575590-103575612 CAGTTACTGCAGTGGCCATGGGG - Exonic
1030539302 7:110809880-110809902 AAGGGTGAGCAGTGGCAAAGAGG - Intronic
1031294350 7:119983336-119983358 CACTGACAGCAGTGGCATGGTGG - Intergenic
1031825865 7:126564399-126564421 CATTGGCATCAGTTGCAATGGGG - Intronic
1032270763 7:130402780-130402802 CAGTGTCATCAGTGGTGTTGGGG - Exonic
1032487259 7:132297188-132297210 GAGTGGCAGCAGCGGCCATGAGG - Intronic
1032893081 7:136220713-136220735 CATTGTCACCTGTGGTAATGCGG + Intergenic
1033285542 7:140037814-140037836 CACTGTCAGCAGTAGCGACGTGG - Exonic
1036076950 8:5512751-5512773 CTGTGTGTGCTGTGGCAATGTGG + Intergenic
1036278633 8:7379689-7379711 CAGTGTCCACAGTGGGAATATGG - Intronic
1036342889 8:7932179-7932201 CAGTGTCCACAGTGGGAATATGG + Intronic
1036369702 8:8152066-8152088 CAATTTCAGCAGGGGAAATGGGG + Intergenic
1036838231 8:12092934-12092956 CAGTGTCCACAGTGGGAATATGG + Intergenic
1036860021 8:12339182-12339204 CAGTGTCCACAGTGGGAATATGG + Intergenic
1036881187 8:12513578-12513600 CAATTTCAGCAGGGGAAATGGGG - Intergenic
1037150026 8:15626066-15626088 CAGGAGCAGCAGTGGCAGTGGGG + Intronic
1037765986 8:21772584-21772606 CAGAGTCAACAGAGGCAATGAGG + Intronic
1037918509 8:22787598-22787620 CTGCGTAAGCAGTGGCAAAGAGG - Intronic
1038133396 8:24759032-24759054 CTATGTCAGCTGTGGCACTGAGG - Intergenic
1039760957 8:40574787-40574809 AGGTGTCTGCAGTGACAATGTGG - Intronic
1039845272 8:41321479-41321501 GAGGGCCAGCAGTGGAAATGGGG - Intergenic
1041190483 8:55348557-55348579 CAGTGTCAGAAGTGGACATGGGG + Intronic
1044124310 8:88438399-88438421 CTGTGGTAGCAGTGGCCATGGGG + Intergenic
1044826923 8:96207670-96207692 CAATGGCAGCAGGGGCTATGCGG - Intergenic
1046358000 8:113113001-113113023 CACAGTCAGCTGTGGCATTGCGG - Intronic
1047705905 8:127499408-127499430 CAGTCACAGCTGTGGGAATGAGG + Intergenic
1048416510 8:134232886-134232908 CAGAGTCAGGAGGGGCCATGTGG + Intergenic
1049251887 8:141593585-141593607 CAGTGTCTGCACAGGCAAGGTGG + Intergenic
1049287189 8:141782243-141782265 CAGTGTTGCCAGTGCCAATGTGG + Intergenic
1050881011 9:10700704-10700726 CAGTGTGAGCAGCAGCACTGTGG - Intergenic
1051463286 9:17348427-17348449 CAATGTCAGCAGAGGAAAAGAGG - Intronic
1053161318 9:35815128-35815150 AAGTGGCTGCAGAGGCAATGGGG - Intronic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1055744451 9:79427288-79427310 AAGTTTCTGCAGTGGCAATGAGG + Intergenic
1056340601 9:85627657-85627679 CTGTCTCAGCAGGGGCAAAGGGG - Intronic
1057565852 9:96165805-96165827 CAGAGGCAGAGGTGGCAATGAGG - Intergenic
1057569564 9:96194088-96194110 CAGTGTCAGAGGAGGCCATGAGG + Intergenic
1057767577 9:97935503-97935525 CAGTGTCAGCAGTGCCAAGGTGG + Intronic
1060102777 9:120855518-120855540 CAGTGGTAGGAGTGGCAAGGTGG + Intergenic
1060413497 9:123415213-123415235 GAGTGTCAGAAGGGGCAATGTGG - Intronic
1062580194 9:137225985-137226007 CAGTGGCAGCAGTGGCAGCAGGG - Exonic
1186344417 X:8677027-8677049 AAATGTCAGCAGTGACAGTGGGG + Intronic
1186642574 X:11472111-11472133 CAGTGTCAGTAGTGCCAAGGTGG - Intronic
1187527385 X:20066375-20066397 CAGTGTAGGCAGTGGGAATGAGG + Intronic
1187846313 X:23541335-23541357 CAGGGGCAGCAGTGGCTATGAGG + Intergenic
1188448084 X:30278185-30278207 CATTGTGAACAGTGCCAATGGGG - Intergenic
1188514903 X:30974787-30974809 CGGTGTCAGCTGGGGCAATGTGG - Intronic
1188600433 X:31956995-31957017 CAGTGTCTGCAGTGGTAGAGTGG + Intronic
1188771327 X:34157905-34157927 CACTGGCAGCAGTGGCACAGCGG + Intergenic
1192982962 X:76366848-76366870 CAGTGGCAGCAGTGGCAGCATGG + Intergenic
1193917910 X:87388597-87388619 CAGTTTCCACAGGGGCAATGTGG + Intergenic
1194366434 X:93019408-93019430 CAGTGGCAGCAGTGGAAGAGGGG - Intergenic
1195834369 X:109096124-109096146 CAGTTGCAACAGTGGCAGTGGGG + Intergenic
1199707116 X:150437300-150437322 CAGTGTCAGCGATGGCAATGTGG + Intronic
1200674661 Y:6135670-6135692 CAGTGGCAGCAGTGGAAGAGGGG - Intergenic