ID: 912317710

View in Genome Browser
Species Human (GRCh38)
Location 1:108681298-108681320
Sequence AGATCGAGACCATCCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912317707_912317710 4 Left 912317707 1:108681271-108681293 CCGAGGTGGGCGGATCACAAGGT 0: 2001
1: 14126
2: 42169
3: 52145
4: 52459
Right 912317710 1:108681298-108681320 AGATCGAGACCATCCTGGGAAGG No data
912317702_912317710 20 Left 912317702 1:108681255-108681277 CCAGCACTCTGGGAGGCCGAGGT 0: 994
1: 39846
2: 181487
3: 254666
4: 173297
Right 912317710 1:108681298-108681320 AGATCGAGACCATCCTGGGAAGG No data
912317698_912317710 29 Left 912317698 1:108681246-108681268 CCTGTAATCCCAGCACTCTGGGA 0: 7643
1: 296201
2: 259723
3: 149283
4: 132738
Right 912317710 1:108681298-108681320 AGATCGAGACCATCCTGGGAAGG No data
912317700_912317710 21 Left 912317700 1:108681254-108681276 CCCAGCACTCTGGGAGGCCGAGG 0: 3332
1: 130072
2: 275858
3: 207561
4: 122598
Right 912317710 1:108681298-108681320 AGATCGAGACCATCCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912317710 Original CRISPR AGATCGAGACCATCCTGGGA AGG Intergenic
No off target data available for this crispr