ID: 912317955

View in Genome Browser
Species Human (GRCh38)
Location 1:108683271-108683293
Sequence TTATGAGCTCCCTTATTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912317951_912317955 -9 Left 912317951 1:108683257-108683279 CCTCCCCTATCTTTTTATGAGCT No data
Right 912317955 1:108683271-108683293 TTATGAGCTCCCTTATTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912317955 Original CRISPR TTATGAGCTCCCTTATTCAG AGG Intergenic
No off target data available for this crispr