ID: 912319876

View in Genome Browser
Species Human (GRCh38)
Location 1:108703154-108703176
Sequence CCAGTAGGTCACCTGAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64551
Summary {0: 1, 1: 17, 2: 535, 3: 6082, 4: 57916}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912319866_912319876 30 Left 912319866 1:108703101-108703123 CCACTAGGTGCAGTGGCTCACAT 0: 1
1: 1
2: 42
3: 186
4: 567
Right 912319876 1:108703154-108703176 CCAGTAGGTCACCTGAGGTCAGG 0: 1
1: 17
2: 535
3: 6082
4: 57916
912319871_912319876 -1 Left 912319871 1:108703132-108703154 CCAGCACTTTGGGAGTCCGAGGC 0: 585
1: 85934
2: 215826
3: 224961
4: 148614
Right 912319876 1:108703154-108703176 CCAGTAGGTCACCTGAGGTCAGG 0: 1
1: 17
2: 535
3: 6082
4: 57916
912319869_912319876 0 Left 912319869 1:108703131-108703153 CCCAGCACTTTGGGAGTCCGAGG 0: 906
1: 127267
2: 280124
3: 209824
4: 119343
Right 912319876 1:108703154-108703176 CCAGTAGGTCACCTGAGGTCAGG 0: 1
1: 17
2: 535
3: 6082
4: 57916

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912319876 Original CRISPR CCAGTAGGTCACCTGAGGTC AGG Intergenic
Too many off-targets to display for this crispr