ID: 912321716

View in Genome Browser
Species Human (GRCh38)
Location 1:108719975-108719997
Sequence TATGGGCCAAGGCAGAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912321703_912321716 20 Left 912321703 1:108719932-108719954 CCAACTTTCCCTAAGTTTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 152
Right 912321716 1:108719975-108719997 TATGGGCCAAGGCAGAATGTAGG No data
912321709_912321716 11 Left 912321709 1:108719941-108719963 CCTAAGTTTGGAGGGGAATGGAA 0: 1
1: 0
2: 0
3: 13
4: 217
Right 912321716 1:108719975-108719997 TATGGGCCAAGGCAGAATGTAGG No data
912321708_912321716 12 Left 912321708 1:108719940-108719962 CCCTAAGTTTGGAGGGGAATGGA No data
Right 912321716 1:108719975-108719997 TATGGGCCAAGGCAGAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912321716 Original CRISPR TATGGGCCAAGGCAGAATGT AGG Intronic
No off target data available for this crispr