ID: 912325117

View in Genome Browser
Species Human (GRCh38)
Location 1:108750644-108750666
Sequence CTAACTAGTTCCTAACTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912325117_912325120 17 Left 912325117 1:108750644-108750666 CCAGTTAGTTAGGAACTAGTTAG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 912325120 1:108750684-108750706 TGTCAGACTCCACAGGTTTAAGG No data
912325117_912325121 18 Left 912325117 1:108750644-108750666 CCAGTTAGTTAGGAACTAGTTAG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 912325121 1:108750685-108750707 GTCAGACTCCACAGGTTTAAGGG No data
912325117_912325119 10 Left 912325117 1:108750644-108750666 CCAGTTAGTTAGGAACTAGTTAG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 912325119 1:108750677-108750699 TAGTTAGTGTCAGACTCCACAGG 0: 1
1: 4
2: 18
3: 71
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912325117 Original CRISPR CTAACTAGTTCCTAACTAAC TGG (reversed) Intronic
902655787 1:17867182-17867204 ATAATTAGTTTCTACCTAACAGG + Intergenic
906275431 1:44511830-44511852 GTATCTAGTTCCAAACTGACTGG - Intronic
906464381 1:46063123-46063145 ATAACTAGTTAATAAATAACTGG - Intronic
908569259 1:65391768-65391790 ATAAATAGTACCTAACTCACAGG - Intronic
909717075 1:78722061-78722083 GTAAATAGTTCCTAACTTAGGGG - Intergenic
909921337 1:81384171-81384193 CTAACAAGTTCCTAATGGACAGG - Intronic
910088868 1:83437896-83437918 CTCACAGGTTCCTAACTACCAGG - Intergenic
912325117 1:108750644-108750666 CTAACTAGTTCCTAACTAACTGG - Intronic
914861153 1:151387265-151387287 CTAACTTGTGCCCAACTAATAGG - Intergenic
916988585 1:170217982-170218004 CTGACTAATTCCTATCTATCTGG - Intergenic
917617344 1:176759629-176759651 CTCAGTAGTTCCTAGCAAACAGG - Intronic
918082690 1:181219905-181219927 CTAGCAAGTTCCTTACTAGCTGG + Intergenic
921309483 1:213828559-213828581 CTGACTTGTTCCTAACTAGCTGG + Intergenic
921541437 1:216421244-216421266 CTACATATTTCCTAACTAATTGG + Intronic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
1068585952 10:58798786-58798808 CCAACTAGAACCTAACTACCAGG - Intronic
1071273192 10:84027839-84027861 CTATCTAGGTCCTACCTAACAGG - Intergenic
1078915326 11:15773475-15773497 CTTACTAGTTGCTAAATAATTGG - Intergenic
1087203934 11:95374344-95374366 CTAACGTGTTCCTCACTGACTGG + Intergenic
1091911755 12:4237124-4237146 CTAACTATATGCTAACAAACTGG - Intergenic
1094570404 12:31636656-31636678 CTAATTATATCCTAAATAACTGG + Intergenic
1099982449 12:89621110-89621132 CTCAGTAGTTCCTACCTAAAAGG - Intronic
1110434794 13:75467077-75467099 CTGACTGGTTCCTAAGTAAACGG + Intronic
1111489519 13:88953732-88953754 CTAACTTCTTCCTAACTATTGGG + Intergenic
1115954000 14:38756316-38756338 CTATTTATTTCCTAATTAACTGG - Intergenic
1128040317 15:64566581-64566603 CTAACTAGTGTTTAGCTAACTGG - Intronic
1129181410 15:73879572-73879594 CTAACAAGCTCCTGAGTAACAGG - Intronic
1154324202 18:13378228-13378250 CTGCCTGGTCCCTAACTAACGGG - Intronic
1157369039 18:47093273-47093295 TTAACTAGTACTTAACTAAGTGG - Intronic
926469534 2:13236784-13236806 CTAACTGGTTCTAATCTAACTGG + Intergenic
926540608 2:14175645-14175667 CTAACTGGTTCTAATCTAACTGG - Intergenic
933195038 2:79379543-79379565 CTAACTAGTTACTAACTCATAGG + Intronic
936664891 2:114583015-114583037 CTAACAAGTTCCCAGGTAACAGG + Intronic
937103167 2:119287109-119287131 ATAACTAGTACCTACCTCACAGG + Intergenic
941973327 2:171376091-171376113 CTTTGTAGTTCTTAACTAACTGG + Intronic
942328559 2:174796692-174796714 CTCACTAGTTCCTAACTTCCTGG - Intergenic
1172296989 20:33819308-33819330 CAAACTAGTTCCTAAACAAATGG - Intronic
1172687302 20:36765883-36765905 TTAACTAGTTCTTTACTAATAGG - Intronic
1175362767 20:58426639-58426661 GTAACTATTTCCTAAGTAAAAGG - Intronic
957955250 3:87178098-87178120 CTAAATAGTTGATAACTAAAGGG - Intergenic
962824843 3:139091283-139091305 CTTAACAGTTCCTAACAAACAGG - Intronic
966396615 3:179510454-179510476 TTAACTAGTTCATCACTAAATGG - Intergenic
974772645 4:66435738-66435760 CTAACAAGTTCCCAGCTGACTGG + Intergenic
978845889 4:113272114-113272136 ATTACTAGTTACTAGCTAACAGG - Intronic
979523006 4:121689879-121689901 CTAAGTAGTTCCTGTCTACCTGG - Intronic
980040829 4:127937952-127937974 ATAATTAGTACCTAAATAACAGG + Intronic
980487872 4:133483472-133483494 CAAACTAGTTCCTAACCGCCTGG + Intergenic
984526906 4:180867760-180867782 CTAACCTGTTCCTAAGTAACCGG - Intergenic
988863521 5:35309186-35309208 CTCACTAGTGTCTAAATAACGGG - Intergenic
989200890 5:38762388-38762410 CTTACTAGTTCCTGACGAGCAGG + Intergenic
989526608 5:42460808-42460830 ATAACTATTTCCTTACTGACAGG - Intronic
989726471 5:44592953-44592975 CTAACTAGTCACTAACTTAAAGG - Intergenic
990902681 5:60770453-60770475 CTAACTAGTTCCTAATCTCCTGG + Intronic
995228161 5:109726858-109726880 CAAACTAATTCCTAATTATCTGG - Intronic
995721783 5:115142825-115142847 CTGATTAGTTCCTAAAGAACTGG - Intronic
995958447 5:117809657-117809679 GTAGCTTGTTCCTAACTTACAGG - Intergenic
999425771 5:151486814-151486836 CTAACAGGTTAGTAACTAACAGG + Intronic
1002632019 5:180588566-180588588 CTAACAATTCCTTAACTAACTGG - Intergenic
1003790006 6:9535633-9535655 TTAACTATTTACTAAATAACAGG - Intergenic
1010145236 6:72660522-72660544 CTAACTACTTCTTAAGAAACAGG - Intronic
1013596231 6:111663345-111663367 CTGACAAGTTTCTAGCTAACGGG - Intronic
1015480672 6:133704544-133704566 CTAACTGGCTACTTACTAACTGG - Intergenic
1019901948 7:4027912-4027934 CTATCTAGATCCTAATTAATTGG - Intronic
1026425143 7:70283891-70283913 ATAGCTGGTTCCTAACTGACAGG - Intronic
1027305720 7:76894332-76894354 CTCACAGGTTCCTAACTACCAGG - Intergenic
1031090680 7:117349956-117349978 TTAACTTGTTCCTAATTAAGAGG - Intergenic
1031440385 7:121787489-121787511 TTAACTAAGTCCTAAGTAACTGG - Intergenic
1037225152 8:16578606-16578628 CTGATTAATTCCTTACTAACTGG + Intergenic
1187516056 X:19971680-19971702 TTAAGTAGTTCCTAACTTAGTGG + Intergenic
1188330751 X:28868267-28868289 CTAACTAGTAAATGACTAACTGG - Intronic
1196556620 X:117092346-117092368 TTAACTAGTTACTAACTAGCTGG - Intergenic